Scrophularia umbrosa
Dumort. · speciesAt a glance
Occurrence records33 764
Data sources14
Biological traits18
DNA specimens16
eDNA detections10
Sources14 archives
Databases and archives Scrophularia umbrosa's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility33 764 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics16 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements2 literature sources18 traits
Chemical compositionLOTUS · NPASS83 compounds
Occurrence & distributionGBIF33 764 records
Environmental DNA1 datasets · 5 countries10 detections
DNA & barcodingBOLD · NCBI16 specimens
Genome at a glanceCCDB · GoaT1.6 Gbp
01Narrative
Scrophularia umbrosa, la Scrofulaire ailée, est une plante herbacée vivace de la famille des Scrofulariacées, assez commune en Europe au bord des eaux. Elle doit son nom vernaculaire aux ailes de la tige généralement larges de plus d'un millimètre.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesLEDATRY
Size & morphology6
Leaf mass124 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 3 793 mm²
Plant height0.7 m
⚠ sources differ — LEDA: 0.7 m · TRY: 0.781 m
Plant height generative0.9 m
Seed length0.767 mm
Seed mass0.075 mg
⚠ sources differ — TRY: 0.075 mg · LEDA: 0.089 mg
Life cycle & reproduction4
Deciduousnessdeciduous
Dispersal typeanimal
Life spanperennial
Raunkiær life formhemicryptophyte
Habitat & environment3
Growth formherb
Mycorrhiza type0.0000393
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)108 mg/g
⚠ sources differ — TRY: 108 mg/g · LEDA: 149 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)38.33 mm²/mg
⚠ sources differ — TRY: 38.33 mm²/mg · LEDA: 29.41 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition83 compounds
Compounds documented for Scrophularia umbrosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Iridoids monoterpenoids11
Proanthocyanins7
Flavan-3-ols5
Flavonols4
Dihydroflavonols2
Documented compounds83 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-taxifolin | present | NPASS | |
| (1S,4aS,5R,7S,7aR)-7-methyl-1-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,5,6,7a-tetrahydrocyclopenta[c]pyran-4a,5,7-triol | present | LOTUS | |
| (2R,2'R,3S,3'S,4S)-2'-(3,4-Dihydroxyphenyl)-3,3',4,4'-tetrahydro-2-(3,4,5-trihydroxyphenyl)(4,8'-bi-2H-1-benzopyran)-3,3',5',7,7'-pentol | present | NPASS | |
| (2R,3R,4S,5S,6R)-2-[[(1S,4aR,5R,7S,7aR)-5,7-dihydroxy-7-methyl-4a,5,6,7a-tetrahydro-1H-cyclopenta[c]pyran-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2R,3S)-2-(3,4-dihydroxyphenyl)-8-[(2R,3S,4R)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-3,4-dihydro-2H-chromene-3,5,7-triol | present | NPASS | |
| (2R,3S)-8-[(2R,3S,4R)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol | present | NPASS | |
| (2R,3S,4R)-2-(3,4-dihydroxyphenyl)-6-[(2R,3S,4S)-2-(3,4-dihydroxyphenyl)-3,7-dihydroxy-3,4-dihydro-2H-chromen-4-yl]-3,4-dihydro-2H-chromene-3,4,7-triol | present | NPASS | |
| (2R,3S,4S)-2-(3,4-dihydroxyphenyl)-6-[(2R,3S,4S)-2-(3,4-dihydroxyphenyl)-3,7-dihydroxy-3,4-dihydro-2H-chromen-4-yl]-3,4-dihydro-2H-chromene-3,4,7-triol | present | NPASS | |
| (2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-[2-(4-hydroxyphenyl)ethoxy]oxane-3,4,5-triol | present | LOTUS | |
| (2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-[[(1R,2S,4S,5S,6S,10S)-2-(hydroxymethyl)-5-methoxy-3,9-dioxatricyclo[4.4.0.02,4]dec-7-en-10-yl]oxy]oxane-3,4,5-triol | present | LOTUS |
05DNA & barcoding16 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scrophularia umbrosa has left across the world's sequence archives.
At a glance
DNA specimens16
Marker genes6
GenBank sequences10
eDNA detections10
Countries5
The DNA barcodea real sequence read deposited for this species
TGTGAAGTAAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGACCGCGAACTTGTGT …
Scrophularia umbrosa voucher 35124 (TUH) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★ITS10★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Scrophularia umbrosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 584 360 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Scrophularia umbrosa1.58 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 26 n = 13
Ploidypolyploid inferred
Chromosome records26–842n range46median26mode30records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2614×CCDB · slov-fl · CCDB · iber-fl · CCDB · fl-europaea +4
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Kochjarová J., 1992: Karyological study of the Slovak flora XXVIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 39: 67-74.
CCDB · slov-fl — Uhríková A., 2007: [New records in Astragalus, Caltha, Cerastium, Dactylorhiza, Gagea, Genista, Geum, Knautia, Linaria, Lithospermum, Oryzopsis, Poa, Polygala, Sanguisorba, Scrophularia, Sorbus, and Vulpia], pp. 120, 140, 185, 221, 222, 272, 288, 293, 345, 371, 374, 424, 458, 460, 520, 533, 557, 558, 629. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iber-fl — Sur la caryologie de quelques plantes rcoltes pendant la III Reunion de Botanique Pninsulaire. Fernandes, A. & M. Queirs.Mem. Soc. Brot.21: 343-385(1971).
CCDB · fl-europaea — Grau, 1976
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · ipcn-api-dl — Ceschmedziev, I. V. 1983a. In IOPB chromosome number reports LXXX. Taxon 32: 506.
CCDB · ipcn-api-dl — Javurkova, V. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 400–401.
CCDB · ipcn-api-dl — Vitek, E., M. Kiehn, K. Pascher, F. Starlinger, J. Greimler, U. Stocker, S. Lehner, P. Beinhofer & A. Blaha. 1992. Beiträge zur Flora von Österreich---weitere Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 129: 215–226.
CCDB · book-ipcn72 — MARKOWA, M. & P. IWANOWA. 1972. Karyologische Untersuchung der vertreter der Fam. Boraginaceae, Labiatae und scrophulariaceae in Bulgarien. Izv. Bot. Inst. (Sofia) 22: 149-157.
CCDB · book-ipcn67-71 — MARKOVA, M.L., & P. ST. IVANOVA. 1971. In IOPB chromosome reports XXXIII. Taxon 20: 609-614.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1970-71. Sur la caryologie de quelque plantes recoltees pendant la Illeme reunion de botanique peninsulaire. Mem. Soc. Broteriana 21: 343-385.
CCDB · book-ipcn67-71 — LALL, S.S. 1970. Materials for a flora of Turkey: XXI: Scrophularia. Notes Roy. Bot. Gard. Edinburgh 30: 129-140.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
2n 526×CCDB · iber-fl · CCDB · fl-europaea · CCDB · book-ipcn67-71 +2
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · fl-europaea — Majovsky et al.,
CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Chromosome numbers of flowering plants in the Netherlands IV. Proc. Roy. Netherlands Acad. Sci. ser. C. 71: 168-183.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · Cave1963 — Gadella & Klip. 1963
2n 784×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · book-ipcn67-71 +1
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Vaarama, A., Hiirsalmi, H. Hereditas (Lund) 58: 333-358 (1967)
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-ipcn75-78 — Loon & Jong 1978
2n 803×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · book-atlas-flowering-plants
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
CCDB · book-atlas-flowering-plants — Maude 1940
2n 401×GoaT · DTOL Flowering Plants Estimates Kew
GoaT · DTOL Flowering Plants Estimates Kew
2n 581×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Grau 1976
2n 841×CCDB · iber-fl
CCDB · iber-fl — Contribucin al estudio cariolgico del gnero Scrophularia L. (Scrophulariaceae) en la Pennsula Ibrica. Ortega Olivencia, A. & J. A. Devesa Alcaraz.Lagascalia16(2): 171-198(1990).
n 422×CCDB · ita-fl · CCDB · iber-fl
CCDB · ita-fl — LOEVE A. - 1970. IOPB chromosome number reports XXVI.. Taxon , 19: 264-269.
CCDB · iber-fl — IOPB. Chromosome number reports. XXVI. Vaarama, A. & R. Leikas.Taxon19(2): 269(1970).
n 131×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — VAARAMA, A., & R. LEIKAS. 1970. In IOPB chromosome number reports XXVI. Taxon 19: 264-269.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type33 764 records
Wild obs. + sensor31 613
Museum / vouchered1 925
Cultivated / captive28
Other198
Origin
Native1 245
Introduced8
Range
Area of Occupancy AOO54 484 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy33% within 1 km
≤100 m 2 595≤1 km 3 524≤10 km 12 450>10 km 198
18 767 georeferenced · 12 846 without coordinates
Open the mapobservation + sensor31 613
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 89≤1 km 305≤10 km 610>10 km 12
1 016 georeferenced · 909 without coordinates
Open the institutions mapphysical evidence1 925
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 10
10 georeferenced · 18 without coordinates
Open the mapnot free-living28
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions33 of 81 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 577 |
| BFLlocation not on record | 225 |
| Moscow State Universitylocation not on record | 170 |
| MeiseBGlocation not on record | 116 |
| BIO-UNIPIlocation not on record | 94 |
| LDlocation not on record | 67 |
| Provincia di Livornolocation not on record | 46 |
| Salzburg, AT | 32 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 32 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 29 |
| Bern, CH | 27 |
| BRNUlocation not on record | 26 |
| Mlocation not on record | 24 |
| PRClocation not on record | 20 |
| Urumqi, CN | 16 |
| Wlocation not on record | 15 |
| Oskarshamn, SE | 14 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 12 |
| Görlitz, DE | 12 |
| GJOlocation not on record | 11 |
| South Kensington, GB | 11 |
| Yangling, CN | 9 |
| Frauenfeld, CH | 9 |
| Beijing, CN | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 8 |
| Adam Mickiewicz University in Poznańlocation not on record | 8 |
| Berlin, DE | 8 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 7 |
| CJBGlocation not on record | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Badajoz, ES | 6 |
| DBF-NHMDlocation not on record | 6 |
| Fulda, DE | 6 |
| Tilburg, NL | 5 |
| Uniwersytet Warszawskilocation not on record | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| Brussel, BE | 5 |
| Kew, GB | 4 |
| GZUlocation not on record | 4 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 4 |
| MAlocation not on record | 4 |
| València, ES | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Zürich, CH | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Dresden, DE | 3 |
| Porrentruy, CH | 3 |
| Karlsruhe, DE | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Vancouver, CA | 2 |
| FLADlocation not on record | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Frankfurt am Main | 2 |
| H-AkrKGlocation not on record | 2 |
| Banyoles, ES | 2 |
| NMBU:MINAlocation not on record | 2 |
| SZUlocation not on record | 2 |
| Paris, FR | 1 |
| Lausanne, CH | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Chengdu, CN | 1 |
| Ivano-Frankove, UA | 1 |
| BClocation not on record | 1 |
| Bratislava, SK | 1 |
| Bloomington, US | 1 |
| SLU Artdatabankenlocation not on record | 1 |
| LfUlocation not on record | 1 |
| Podgorica, ME | 1 |
| Tromso University Museumlocation not on record | 1 |
| WTUlocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| ESP003location not on record | 1 |
| San Sebastián, ES | 1 |
| Pamplona, ES | 1 |
| Namur, BE | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
81 institutions · 1 764 of 1 925 vouchered records shown · 129 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA10 detections
Where the DNA of Scrophularia umbrosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map5 countries0
in moist tall grassland along road verge
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.0 °C 10.3–19.3
Seasonal swing summer↔winter14.5 °C
Max temp (day)19.6 °C 12.4–23.7
Min temp (night)13.8 °C 7.30–15.1
Precipitation81.9 mm/mo 35.3–90.7
Air humidity62.8 % 53.0–65.2
Moisture balance-19.2 mm/mo -80.6–12.0
Vapour deficit746 Pa 467–1,234
Wind speed3.90 m/s 2.80–5.40
Cloud cover39.1 % 31.6–53.3
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.