Scrophularia peregrina

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Scrophulariaceae/Scrophularia

At a glance

Occurrence records3 756

Data sources11

Biological traits17

DNA specimens6

eDNA detections5

Sources11 archives

Databases and archives Scrophularia peregrina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 756 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF3 756 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Scrophularia peregrina, the Mediterranean figwort, is a species of annual herb in the family Scrophulariaceae. They have a self-supporting growth form. Individuals can grow to 0.39 m. (MHNT) Scrophularia peregrina - Inflorescence.jpg|Inflorescence (MHNT) Scrophularia peregrina - Immature Infrutescence.jpg|Infrutescence

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height0.4 m

Plant height max0.6 m

Plant height min0.3 m

Life cycle & reproduction6

Flowering endJun

Flowering startMay

Life formannual

Life spanannual

Lifespan years1 years

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTÁrea Antrópica

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scrophularia peregrina has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences5

eDNA detections5

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKC692572.1 ↗551 bpGreece

ACGT

GTGAACTTGTGTTTATAACTATAGGCCTCGGCCCCATCCCCTAGCGCGAAAGCGACCGTCGTGTGGGCTAACGAACCCCCGGCGCGGCAT …

Scrophularia peregrina voucher 112PV05 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Scrophularia peregrina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records36–362n range36median36mode14records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3614×CCDB · ita-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +4

CCDB · ita-fl — GRAU J. - 1976. Die cytologie sudwestmediterraner Scrophularia-Arten.. Mitt. Bot. Staatssamml. Munchen , 12: 609-654.

CCDB · fl-europaea — Vaarama & Leikas,

CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.

CCDB · book-ipcn72 — KRAMER, K.U., L.Y TH.WESTRA, E. KLIPHUIS, & T.W.J. GADELLA. 1972. Floristic and cytotaxonomic notes on the flora of the Maltese islands. Acta Bot. Neerl. 21: 54-66 .

CCDB · book-ipcn67-71 — LALL, S.S. 1970. Materials for a flora of Turkey: XXI: Scrophularia. Notes Roy. Bot. Gard. Edinburgh 30: 129-140.

CCDB · book-ipcn67-71 — VAARAMA, A., H. HIIRSALMI. 1967. Chromosome studies in some Old World species of the genus Scrophularia. Hereditas 58: 333-358.

CCDB · book-ipcn67-71 — VAN LOON, J.C., T.W.J. GADELLA, & E. KLIPHUIS. 1971. Cytological studies in some flowering plants from Southern France. Acta Bot. Neerl. 20: 157-166.

CCDB · book-ipcn73-74 — STRID, A. 1971. Chromosome numbers in some Albanian angiosperms. Bot. Notiser 124: 490-496.

CCDB · CromoCat 2015 — Loon van, J. C. & Kieft, B. (1980a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 538-542. si

CCDB · CromoCat 2015 — Grau, J. (1976). Die cytologie südwestmediterraner Scrophularia-Arten. Mitt. Bot. Staatssamml. München 12: 609-654.

CCDB · CromoCat 2015 — Kramer, K. U., Westra, L. Y., Kliphuis, E. & Gadella, T. W. (1972). Floristic and cytotaxonomic notes on the flora of the Maltese Islands. Acta Bot. Neerl. 21: 54-66.

CCDB · CromoCat 2015 — Lall, S. S. (1970). Materials for a flora of Turkey: XXI: Scrophularia. Notes Roy. Bot. Gard. Edinburgh 30: 129-140.

CCDB · CromoCat 2015 — Loon van, J. C., Gadella, Th. W. J. & Kliphuis, E. (1971). Cytological studies in some flowering plants from Southern France. Acta Bot. Neerl. 20: 157-166.

CCDB · CromoCat 2015 — Ortega Olivencia, A. & J. A. Devesa Alcaraz. (1990a). Contribución al estudio cariológico del género Scrophularia L. (Scrophulariaceae) en la Península Ibérica e Islas Baleares. Lagascalia 16(2): 171-198.

n 183×CCDB · book-ipcn67-71 · CCDB · Cave1962 · CCDB · CromoCat 2015

CCDB · book-ipcn67-71 — VAARAMA, A., & R. LEIKAS. 1970. In IOPB chromosome number reports XXVI. Taxon 19: 264-269.

CCDB · Cave1962 — Shaw 1962

CCDB · CromoCat 2015 — Vaarama, A. & R. Leikas. (1970). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXVI]. Taxon 19(2): 269.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.968 ↗

08Occurrence & distribution

Record type3 756 records

Wild obs. + sensor3 087

Museum / vouchered621

Other48

Origin

Native16

Introduced27

Range

Area of Occupancy AOO8 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 1 032≤1 km 246≤10 km 863>10 km 44

2 185 georeferenced · 902 without coordinates

Open the mapobservation + sensor3 087

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 15≤1 km 37≤10 km 50>10 km 4

106 georeferenced · 515 without coordinates

Open the institutions mapphysical evidence621

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 59 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	203
Berlin, DE	76
LDlocation not on record	67
BDBClocation not on record	37
Barcelona, ES	25
UIBlocation not on record	14
Institut und Museum fuer Geologie und Palaeontologielocation not on record	14
València, ES	14
Badajoz, ES	12
MAlocation not on record	11
BClocation not on record	9
Wlocation not on record	9
GJOlocation not on record	9
Paris, FR	7
Granada, ES	6
Moscow State Universitylocation not on record	6
CJBGlocation not on record	5
ISAlocation not on record	5
Frankfurt am Main	5
Oskarshamn, SE	4
Adam Mickiewicz University in Poznańlocation not on record	4
BRNUlocation not on record	4
Claremont, US	3
Riverside, US	3
Uppsala, SE	3
Salamanca, ES	3
College of the Atlantic, Museumlocation not on record	3
Blumenau, BR	2
JBSlocation not on record	2
SNSNMClocation not on record	2
Bronx, US	2
Canadian Department of Agriculturelocation not on record	2
UFPRlocation not on record	2
FUVATESlocation not on record	2
Entomological Society of Latvialocation not on record	2
Universidade Federal de Goiáslocation not on record	1
UFSClocation not on record	1
Universidade Federale do Rio Grande do Sullocation not on record	1
US	1
UTFPR-CPlocation not on record	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Universidade Federal de Santa Catarinalocation not on record	1
Henry Brockhouse Collectionlocation not on record	1
Porvoo, FI	1
Vitoria, ES	1
CICYTEXlocation not on record	1
Jaén, ES	1
Baroda, IN	1
Sevilla, ES	1
Alicante, ES	1
Stockholm, SE	1
Campo Mourão, BR	1
Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze \| Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record	1
Hunan Geological Museumlocation not on record	1
Olocation not on record	1
Davis, US	1
Dresden, DE	1
UNESP-IBILCElocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1

59 institutions · 601 of 621 vouchered records shown · 18 without an institution code

09Environmental DNA5 detections

Where the DNA of Scrophularia peregrina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 12.3–16.4

Seasonal swing summer↔winter18.8 °C

Max temp (day)17.3 °C 16.4–18.3

Min temp (night)10.7 °C 7.30–14.1

Precipitation70.7 mm/mo 58.3–83.1

Air humidity62.7 % 62.6–62.8

Moisture balance-18.6 mm/mo -45.0–7.70

Vapour deficit674 Pa 606–741

Wind speed2.40 m/s 1.90–2.90

Cloud cover41.2 % 38.9–43.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Scrophularia peregrina

At a glance

Sources11 archives

Size & morphology3

Life cycle & reproduction6

Diet & foraging1

Habitat & environment7

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 756 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions25 of 59 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 756 records