Scrophularia nodosa
speciesAt a glance
Occurrence records387 893
Data sources15
Biological traits56
DNA specimens45
eDNA detections22
Sources15 archives
Databases and archives Scrophularia nodosa's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility387 893 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics45 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources56 traits
Chemical compositionLOTUS · NPASS93 compounds
Occurrence & distributionGBIF387 893 records
Environmental DNA1 datasets · 7 countries22 detections
DNA & barcodingBOLD · NCBI45 specimens
Genome at a glanceCCDB · GoaT763 Mbp
01Narrative
Scrophularia nodosa (also called figwort, woodland figwort, and common figwort) is a perennial herbaceous plant found in temperate regions of the Northern hemisphere except western North America.Mills, S., The Complete Guide to Modern Herbalism, Thorsons, Great Britain, 1994. It grows in moist and cultivated waste ground.PLANTS Profile for Scrophularia nodosa (woodland figwort) | USDA PLANTS
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology19
Fruit length6 mm
Leaf length32.5 mm
Leaf length max140 mm
Leaf length min25 mm
Leaf mass314 mg
Leaf size3 655 mm²
⚠ sources differ — TRY: 3 655 mm² · LEDA: 8 166 mm² · GIFT: 8 166 mm²
Leaf width37.5 mm
⚠ sources differ — AusTraits: 37.5 mm · GIFT: 60 mm
Leaf width max60 mm
Leaf width min15 mm
Petiole length0.75 cm
Plant height0.583 m
⚠ sources differ — GIFT: 0.583 m · LEDA: 0.6 m · TRY: 0.76 m
Plant height generative0.769 m
Plant height max1.25 m
Plant height min0.3 m
Seed length0.86 mm
Seed mass0.098 mg
⚠ sources differ — TRY: 0.098 mg · LEDA: 0.09 mg · GIFT: 0.099 mg
Seed volume0.091 mm³
Seed volume max0.091 mm³
Seed volume min0.091 mm³
Life cycle & reproduction15
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeself
⚠ sources differ — LEDA: boleochor · GIFT: anemochorous
Flowering endSep
Flowering startJun
Flowering timeyynnnnnnnnny
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan years3.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number8 395
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 200 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTcrop fields, forest, meadows, old fields, shrubberies
Leaf compoundnesssimple
Leaf shapeovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry6
Leaf c490 mg/g
Leaf dry-matter content (LDMC)165 mg/g
⚠ sources differ — TRY: 165 mg/g · LEDA: 182 mg/g
Leaf n28.82 mg/g
Photosynthetic pathwayC3
Seed longevity index1
Specific leaf area (SLA)28.35 mm²/mg
⚠ sources differ — TRY: 28.35 mm²/mg · LEDA: 26 mm²/mg · GIFT: 26 mm²/mg
Other traits1
Diaspore typegerminule
03Chemical composition93 compounds
Compounds documented for Scrophularia nodosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Iridoids monoterpenoids38
Cinnamic acids and derivatives $ Phenylethanoids18
Cinnamic acids and derivatives4
Unsaturated fatty acids4
Simple phenolic acids2
Documented compounds93 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+/-)-2-Hydroxypiperitone | present | NPASS | |
| (1R,4aS,5R,7S,7aR)-7-methyl-1-[(2R,3R,4R,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,5,6,7a-tetrahydrocyclopenta[c]pyran-4a,5,7-triol | present | LOTUS | |
| (1S,4aS,6S,7S,7aR)-6-[(E)-3-(4-methoxyphenyl)prop-2-enoyl]oxy-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylic acid | present | LOTUS | |
| (1S,4aS,6S,7S,7aS)-6-[(E)-3-(4-methoxyphenyl)prop-2-enoyl]oxy-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylic acid | present | LOTUS | |
| (2R,3R,4R,5R,6R)-2-[[(1S,4aS,5R,7aR)-5-hydroxy-7-(hydroxymethyl)-1,4a,5,7a-tetrahydrocyclopenta[c]pyran-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (9R)-O~3~-[(2S)-2,5-dihydroxy-2-(2-methoxy-2-oxoethyl)-5-methylhexanoyl]cephalotaxine | present | NPASS | |
| 2-Propenoic acid, 3-phenyl- | present | LOTUS | |
| 4-Hydroxybenzoic acid | present | LOTUS | |
| 5-Hydroxymethyl-2-furancarboxaldehyde | present | LOTUS | |
| [(2R,3R,4R,5R,6R)-5-hydroxy-6-[2-(3-hydroxy-4-methoxyphenyl)ethoxy]-4-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2-[[(2R,3S,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxan-3-yl] (E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoate | present | LOTUS |
05DNA & barcoding45 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scrophularia nodosa has left across the world's sequence archives.
At a glance
DNA specimens45
Marker genes7
GenBank sequences10
eDNA detections22
Countries9
The DNA barcodea real sequence read deposited for this species
GAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCTCCCAATCC …
Scrophularia nodosa voucher CCDB-20338-C04 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL4★rbcLa★ITS6★ITS1★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Scrophularia nodosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size762 840 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Scrophularia nodosa0.76 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidypolyploid inferred
Chromosome records18–362n range36median36mode49records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3648×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +12
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GRAU J. - 1976. Die cytologie sudwestmediterraner Scrophularia-Arten.. Mitt. Bot. Staatssamml. Munchen , 12: 609-654.
CCDB · ita-fl — MORI M. - 1957. Note brevi. Il numero cromosomico diploide di alcune specie di angiosperme raccolte nella tenuta di S. Rossore (Pisa).. Caryologia , 9(2): 365-368.
CCDB · ita-fl — Verlaque R., Contandriopoulos J., Aboucaya A. - 1993. Recherches cyto-biogographiques sur quelques taxons rare out endmiques de Corse: I.. Candollea , 48: 562-576.
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · slov-fl — Vaarama A. & Hiirsalmi H., 1967: Chromosome studies on some Old world species of the genus Scrophularia. - Hereditas (Lund) 58: 333-358.
CCDB · slov-fl — Hallonová A., 1982: Floristické pomery horskej skupiny Skalky (Strážovské vrchy). - Stredné Slovensko 2: 308-323.
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3583
CCDB · fl-europaea — Gadella & Kliphuis,
CCDB · poland — Vaarama A. and Hirsalmi H. 1967. Chromosome studies on some old world species of the genus Scrophularia. Hereditas 58, 333-358.
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1987. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II. Zapov. Belorussii Issl. 11: 62–69.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Verlaque, R., J. Contandriopoulos & A. Aboucaya. 1992. IOPB chromosome data 4. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 18/19: 9–10.
CCDB · ipcn-api-dl — Verlaque, R., J. Contandriopoulos & A. Aboucaya. 1993. Recherches cyto-biogĕographiques sur quelques taxons rares ou endĕmiques de Corse: I. Candollea 48(2): 562–576.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.
CCDB · book-ipcn72 — GADELLA, T., & E. KLIPHUIS. 1972. studies in chromosome numbers of Yugoslavian angiosperms. Acta Bot. Croatica 31: 91-103.
CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Chromosome numbers of flowering plants in the Netherlands IV. Proc. Roy. Netherlands Acad. Sci. ser. C. 71: 168-183.
CCDB · book-ipcn67-71 — VAARAMA, A., H. HIIRSALMI. 1967. Chromosome studies in some Old World species of the genus Scrophularia. Hereditas 58: 333-358.
CCDB · book-ipcn67-71 — GADELLA, T.W.J., & E. KLIPHUIS. 1971. Chromosome numbers of flowering plants in the Netherlands v. Proc. Kon. Ned. Acad. Wetensch. ser C 74:
CCDB · book-ipcn67-71 — SKALINSKA, M., A. JANKUN, H. WCISLO ET AL. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov., Ser. Bot. 14: 55-102.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-atlas-flowering-plants — Scheerer 1939
CCDB · Cave1963 — Gadella & Klip. 1963
CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Cheshmedziev, I. V. (1994). Reports (313-366). Fl. Medit. 4: 269-279.
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — Hollingsworth, P. M., Gornall, R. J. & Bailey, J. P. (1992). Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134-137.
CCDB · CromoCat 2015 — Loon van, J. C. & de Jong, H. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIX]. Taxon 27(1): 56-61.
CCDB · CromoCat 2015 — Loon van, J. C. & Kieft, B. (1980a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 538-542. si
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
+6 more references
2n 181×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 25
n 185×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · Cave1962 +1
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · book-ipcn67-71 — LAANE, M.M. 1969. Meiosis and structural hybridity in some Norwegian plant species. Blyttia 27: 141-173.
CCDB · Cave1962 — Shaw 1962
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Mesí?ek, J. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesícek & V. Javurková-Jarolímová. Academia, Praha NONE LISTED
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
07Deep time~2.98 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin2.98 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type387 893 records
Wild obs. + sensor373 838
Museum / vouchered11 939
Cultivated / captive245
Other1 871
Origin
Native26 835
Introduced48
Range
Area of Occupancy AOO484 484 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy44% within 1 km
≤100 m 62 717≤1 km 74 522≤10 km 173 748>10 km 2 321
313 308 georeferenced · 60 530 without coordinates
Open the mapobservation + sensor373 838
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy33% within 1 km
≤100 m 582≤1 km 2 360≤10 km 5 839>10 km 174
8 955 georeferenced · 2 984 without coordinates
Open the institutions mapphysical evidence11 939
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy7% within 1 km
≤1 km 1≤10 km 2>10 km 12
15 georeferenced · 230 without coordinates
Open the mapnot free-living245
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions77 of 166 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 5 900 |
| BFLlocation not on record | 544 |
| Olocation not on record | 454 |
| BIO-UNIPIlocation not on record | 369 |
| Moscow State Universitylocation not on record | 367 |
| LDlocation not on record | 308 |
| Trondheim, NO | 269 |
| MeiseBGlocation not on record | 218 |
| Salzburg, AT | 201 |
| Bergen, NO | 145 |
| TROMlocation not on record | 138 |
| Oulu, FI | 125 |
| Tartu, EE | 122 |
| Adam Mickiewicz University in Poznańlocation not on record | 117 |
| Oskarshamn, SE | 110 |
| Turku, FI | 105 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 87 |
| Uniwersytet Warszawskilocation not on record | 81 |
| KMNlocation not on record | 79 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 67 |
| SLU Artdatabankenlocation not on record | 61 |
| Provincia di Livornolocation not on record | 54 |
| Jyväskylä, FI | 54 |
| BRNUlocation not on record | 54 |
| Görlitz, DE | 51 |
| Kuopio, FI | 51 |
| Uniwersytet Śląski w Katowicachlocation not on record | 44 |
| TUR-Alocation not on record | 43 |
| Berlin, DE | 37 |
| BDBClocation not on record | 37 |
| Uppsala, SE | 37 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 35 |
| Tallinn, EE | 35 |
| South Kensington, GB | 32 |
| Bern, CH | 27 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 26 |
| Wlocation not on record | 23 |
| Barcelona, ES | 22 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 19 |
| GJOlocation not on record | 19 |
| Karlsruhe, DE | 16 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 16 |
| Frankfurt am Main | 16 |
| UGentlocation not on record | 15 |
| Dresden, DE | 15 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 14 |
| Zürich, CH | 14 |
| Porrentruy, CH | 13 |
| Mlocation not on record | 13 |
| PRClocation not on record | 13 |
| Natural History Museum Rotterdamlocation not on record | 12 |
| Helsinki, FI | 10 |
| Tula State Universitylocation not on record | 8 |
| Mount Annan, AU | 8 |
| PrivatHerblocation not on record | 8 |
| CJBGlocation not on record | 8 |
| BClocation not on record | 8 |
| Badajoz, ES | 8 |
| Zürich, CH | 8 |
| Stockholm, SE | 7 |
| Fulda, DE | 7 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 7 |
| Porvoo, FI | 6 |
| Chongqing Museumlocation not on record | 6 |
| València, ES | 6 |
| Tilburg, NL | 6 |
| MAlocation not on record | 6 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 6 |
| Glarus, CH | 6 |
| University of New Hampshirelocation not on record | 5 |
| CICYTEXlocation not on record | 5 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 5 |
| Kew, GB | 5 |
| DBF-NHMDlocation not on record | 5 |
| Toronto, CA | 5 |
| Auckland, NZ | 5 |
| National Museum Waleslocation not on record | 4 |
| Frauenfeld, CH | 4 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 4 |
| WTUlocation not on record | 4 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 4 |
| Paris, FR | 4 |
| Christchurch, NZ | 4 |
| Chengdu, CN | 4 |
| Bourges, FR | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| Durham, US | 3 |
| Saint John, CA | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Pamplona, ES | 3 |
| NMBU:MINAlocation not on record | 3 |
| Acadia Universitylocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Forssa, FI | 3 |
| Davenport, US | 3 |
| LfUlocation not on record | 3 |
| Vancouver, CA | 3 |
| SZUlocation not on record | 3 |
| FLADlocation not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Saint Louis, US | 2 |
| H-Schuhwlocation not on record | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| Hazara Universitylocation not on record | 2 |
| BGBMlocation not on record | 2 |
| Tromso University Museumlocation not on record | 2 |
| Burlington, US | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 2 |
| Adelaide, AU | 2 |
| Nanjing, CN | 2 |
| Uniwersytet w Białymstokulocation not on record | 2 |
| DULlocation not on record | 2 |
| nbflocation not on record | 2 |
| Salamanca, ES | 2 |
| Sion, CH | 2 |
| Monastir, TN | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| Hobart, AU | 2 |
| Canberra, AU | 2 |
| Logan, US | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Córdoba, ES | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Wuzhou, CN | 1 |
| Bronx, US | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| Rovaniemi, FI | 1 |
| ULBF-AGRlocation not on record | 1 |
| SNSNMClocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Gijón, ES | 1 |
| Salvador, BR | 1 |
| Montréal, CA | 1 |
| GZUlocation not on record | 1 |
| EL PASO, US | 1 |
| Kingston, US | 1 |
| Xiamen, CN | 1 |
| Nijmegen, NL | 1 |
| Rotorua, NZ | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Boumlocation not on record | 1 |
| St. Paul, US | 1 |
| ESP003location not on record | 1 |
| ROM007location not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| CJBNlocation not on record | 1 |
| BSBIlocation not on record | 1 |
| Dhaka, BD | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Macomb, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Namur, BE | 1 |
| H-HarzKurtlocation not on record | 1 |
| Taipei, TW | 1 |
| Podgorica, ME | 1 |
| Umeå Universitylocation not on record | 1 |
| Université Lavallocation not on record | 1 |
| Pamplona, ES | 1 |
| Staten Island, US | 1 |
166 institutions · 11 054 of 11 939 vouchered records shown · 686 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA22 detections
Where the DNA of Scrophularia nodosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found22
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 22 detections have coordinates
Open the map7 countries0
Stream on rip-rap.Wet area beside bicycle pathHumber R. bank.Clay soil on side of woodland path
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.2 °C 9.50–19.2
Seasonal swing summer↔winter15.7 °C
Max temp (day)17.2 °C 12.1–23.4
Min temp (night)10.4 °C 7.00–16.3
Precipitation80.4 mm/mo 59.2–100
Air humidity62.5 % 59.3–65.8
Moisture balance-17.9 mm/mo
Vapour deficit602 Pa 440–893
Wind speed3.90 m/s
Cloud cover46.3 % 39.7–57.2
CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.