Scrophularia canina
speciesAt a glance
Occurrence records12 804
Data sources12
Biological traits37
DNA specimens5
eDNA detections9
Sources12 archives
Databases and archives Scrophularia canina's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility12 804 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics5 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources37 traits
Chemical compositionLOTUS12 compounds
Occurrence & distributionGBIF12 804 records
Environmental DNA1 datasets · 3 countries9 detections
DNA & barcodingBOLD · NCBI5 specimens
Genome at a glanceCCDB2n = 26
01Narrative
Scrophularia canina, la scrofulaire des chiens, est une plante herbacée de la famille des Scrofulariacées appartenant au genre Scrophularia.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass20.95 mg
Leaf size347 mm²
Plant height0.3 m
⚠ sources differ — GIFT: 0.3 m · LEDA: 0.3 m · TRY: 0.403 m
Plant height generative0.4 m
Plant height max0.6 m
Plant height min0.2 m
Seed length0.92 mm
Seed mass0.553 mg
⚠ sources differ — TRY: 0.553 mg · LEDA: 0.18 mg · GIFT: 0.463 mg
Seed mass max1 mg
Seed mass min0.33 mg
Life cycle & reproduction12
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeself
Flowering endAug
Flowering startMay
Life formperennial
Life spanperennial
Lifespan years4.67 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTstony places
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)166 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)17.15 mm²/mg
Other traits2
Diaspore typeseed
Shoot orientationascending
03Chemical composition12 compounds
Compounds documented for Scrophularia canina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Unsaturated fatty acids8
Iridoids monoterpenoids3
Branched fatty acids $ Unsaturated fatty acids1
Documented compounds12 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 11-Eicosenoic Acid | present | LOTUS | |
| [(4aS,7S,7aR)-4a,5-dihydroxy-7-methyl-1-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,5,6,7a-tetrahydrocyclopenta[c]pyran-7-yl] acetate | present | LOTUS | |
| alpha-Linolenic acid | present | LOTUS | |
| Aucubin | present | LOTUS | |
| Eicosanic acid | present | LOTUS | |
| Gamma-Linolenic acid | present | LOTUS | |
| Harpagide | present | LOTUS | |
| Hexadecenoic acid | present | LOTUS | |
| Linonelic acid | present | LOTUS | |
| oleate | present | LOTUS |
05DNA & barcoding5 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scrophularia canina has left across the world's sequence archives.
At a glance
DNA specimens5
Marker genes3
GenBank sequences10
eDNA detections9
Countries5
The DNA barcodea real sequence read deposited for this species
AACTCAACGAAGCGCCTCCCCGGCGATGCCCCGTTCGCGGTGTGCTCACCGGGACAGTGCGTCTCTTGAATGTCATAACGACTCTCGGCA …
Scrophularia canina subsp. canina internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL2★ITS7
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Scrophularia canina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 26 n = 13
Ploidydiploid inferred
Chromosome records12–582n range26median26mode27records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2615×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. Fernandes, A., M. Queirs & M. F. Santos.Bol. Soc. Brot. ser. 251: 37-90(1977).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · ipcn-api-dl — Boscaiu, M., J. Riera, E. Estrelles & J. Güemes. 2000. Números cromosomáticos de plantas occidetales, 827--848. Anales Jard. Bot. Madrid 58(1): 163–164.
CCDB · book-ipcn67-71 — VAARAMA, A., H. HIIRSALMI. 1967. Chromosome studies in some Old World species of the genus Scrophularia. Hereditas 58: 333-358.
CCDB · book-ipcn67-71 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797:-
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · book-ipcn73-74 — MARKOVA, M.L., & P. IVANOVA. 1973. In IOPB chromosome number reports XL. Taxon 22: 285-291.
CCDB · book-atlas-flowering-plants — Rodrigues 1953
CCDB · CromoCat 2015 — Boscaiu, M., Riera, J., Estrelles, E. & Güemes, J. (2000). Números cromosomáticos de plantas occidentales, 827-848. Anales Jard. Bot. Madrid 58(1): 163-164.
CCDB · CromoCat 2015 — Fernandes, A., Queirós, M. & Santos, M. F. (1977b). Contribution à la connaissance cytotaxinomique des Spermatophytes du Portugal. Bol. Soc. Brot. 51: 37-90.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.
CCDB · CromoCat 2015 — Markova, M. & Ivanova, P. (1975). Karyologische Untersuchungen der Vertreter der Fam. Boraginaceae, Labiatae und Scrophulariaceae in IV. In: In honour acad. D. Jordanov : 61-67.
CCDB · CromoCat 2015 — Markova, M. L. & Ivanova, P. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XL]. Taxon 22(2/3): 289-290.
CCDB · CromoCat 2015 — Ortega Olivencia, A. & J. A. Devesa Alcaraz. (1990a). Contribución al estudio cariológico del género Scrophularia L. (Scrophulariaceae) en la Península Ibérica e Islas Baleares. Lagascalia 16(2): 171-198.
2n 246×CCDB · ita-fl · CCDB · iber-fl · CCDB · fl-europaea +2
CCDB · ita-fl — KUEPFER P. - 1974. Recherches sur les lieus de parent entre la flore orophile des Alpes et celle des Pyrnes.. Boissiera , 23: 1-322.
CCDB · iber-fl — Contribucin al estudio cariolgico del gnero Scrophularia L. (Scrophulariaceae) en la Pennsula Ibrica. Ortega Olivencia, A. & J. A. Devesa Alcaraz.Lagascalia16(2): 171-198(1990).
CCDB · fl-europaea — Grau, ined.
CCDB · ipcn-api-dl — Ortega Olivencia, A. & J. A. D. Alcaraz. 1991. Contribución al estudio cariológico del género Scrophularia L. (Scrophulariaceae) en la Península Ibérica e Islas Baleares. Lagascalia 16: 171–198.
CCDB · CromoCat 2015 — Ortega Olivencia, A. & J. A. Devesa Alcaraz. (1990a). Contribución al estudio cariológico del género Scrophularia L. (Scrophulariaceae) en la Península Ibérica e Islas Baleares. Lagascalia 16(2): 171-198.
2n 302×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Contribucin al estudio cariolgico del gnero Scrophularia L. (Scrophulariaceae) en la Pennsula Ibrica. Ortega Olivencia, A. & J. A. Devesa Alcaraz.Lagascalia16(2): 171-198(1990).
CCDB · CromoCat 2015 — Ortega Olivencia, A. & J. A. Devesa Alcaraz. (1991). Contribución al estudio cariológico del género Scrophularia L. (Scrophulariaceae) en la Península Ibérica e Islas Baleares. Lagascalia 16: 171-198.
2n 121×CCDB · iber-fl
CCDB · iber-fl — Planes de recuperacin de especies vegetales amenazadas en el parque natural de la sierra de Grazalema (Cdiz-Mlaga). Aparicio, A.Acta Bot. Malacitana18: 199-221(1993).
2n 221×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Mesquita Rodrigues, J. E. (1956). Sobre a cariologia de Scrophularia canina L. Las Ciencias 21: 1-15.
2n 451×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Mesquita Rodrigues, J. E. (1956). Sobre a cariologia de Scrophularia canina L. Las Ciencias 21: 1-15.
2n 511×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Mesquita Rodrigues, J. E. (1956). Sobre a cariologia de Scrophularia canina L. Las Ciencias 21: 1-15.
2n 521×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Mesquita Rodrigues, J. E. (1956). Sobre a cariologia de Scrophularia canina L. Las Ciencias 21: 1-15.
2n 581×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Mesquita Rodrigues, J. E. (1956). Sobre a cariologia de Scrophularia canina L. Las Ciencias 21: 1-15.
n 126×CCDB · ita-fl · CCDB · iber-fl · CCDB · book-ipcn75-78 +1
CCDB · ita-fl — LOEVE A. - 1970. IOPB chromosome number reports XXVI.. Taxon , 19: 264-269.
CCDB · iber-fl — Estudios cariolgicos sobre la flora espaola. Fernndez Piqueras, J. & M. Ruz Rejn.Bol. Soc. Brot. ser. 250: 5-13(1976).
CCDB · iber-fl — IOPB. Chromosome number reports. LII. Ruz Rejn, M.Taxon25(2/3): 341-342(1976).
CCDB · book-ipcn75-78 — Fernandez Piqueras & Ruiz Rejon 1976
CCDB · book-ipcn75-78 — Messia & Rejon 1976a
CCDB · CromoCat 2015 — Vasudevan, K. N. (1975b). Contribution to the cytotaxonomy and cytogeography of the flora of the western Himalayas (with an attempt to compare it with the flora of the Alpes). Part II. Ber. Schweiz. Bot. Ges. (Bull. Soc. Bot. Suisse) 85: 210-252.
n 136×CCDB · ita-fl · CCDB · iber-fl · CCDB · book-ipcn67-71 +2
CCDB · ita-fl — LOEVE A. - 1970. IOPB chromosome number reports XXVI.. Taxon , 19: 264-269.
CCDB · iber-fl — IOPB. Chromosome number reports. LII. Ruz Rejn, M.Taxon25(2/3): 341-342(1976).
CCDB · book-ipcn67-71 — VAARAMA, A., & R. LEIKAS. 1970. In IOPB chromosome number reports XXVI. Taxon 19: 264-269.
CCDB · book-ipcn75-78 — Messia & Rejon 1976a
CCDB · CromoCat 2015 — Palomeque, T. & M. Ruiz. (1976b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LII]. Taxon 25(2/3): 346.
CCDB · CromoCat 2015 — Vaarama, A. & R. Leikas. (1970). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXVI]. Taxon 19(2): 269.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type12 804 records
Wild obs. + sensor11 472
Museum / vouchered1 255
Cultivated / captive6
Other71
Origin
Native572
Range
Area of Occupancy AOO21 652 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy23% within 1 km
≤100 m 1 123≤1 km 1 184≤10 km 7 619>10 km 59
9 985 georeferenced · 1 487 without coordinates
Open the mapobservation + sensor11 472
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 32≤1 km 162≤10 km 206>10 km 4
404 georeferenced · 851 without coordinates
Open the institutions mapphysical evidence1 255
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 6 records without
Open the mapnot free-living6
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions41 of 85 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 411 |
| València, ES | 73 |
| LDlocation not on record | 60 |
| Zürich, CH | 38 |
| CICYTEXlocation not on record | 38 |
| MAlocation not on record | 36 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 32 |
| BClocation not on record | 30 |
| Bern, CH | 28 |
| Wlocation not on record | 25 |
| Adam Mickiewicz University in Poznańlocation not on record | 24 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 21 |
| Salamanca, ES | 21 |
| Córdoba, ES | 18 |
| Entomological Society of Latvialocation not on record | 18 |
| College of the Atlantic, Museumlocation not on record | 17 |
| Barcelona, ES | 15 |
| Granada, ES | 14 |
| BRNUlocation not on record | 14 |
| Madrid, ES | 13 |
| BDBClocation not on record | 13 |
| Phyletisches Museum Jenalocation not on record | 12 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 11 |
| Zürich, CH | 11 |
| Oskarshamn, SE | 10 |
| UGentlocation not on record | 10 |
| Alicante, ES | 9 |
| Badajoz, ES | 9 |
| UIBlocation not on record | 9 |
| San Sebastián, ES | 8 |
| Porvoo, FI | 8 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 7 |
| Museo Achille Folettolocation not on record | 7 |
| Berlin, DE | 7 |
| MeiseBGlocation not on record | 6 |
| Kew, GB | 6 |
| JBSlocation not on record | 6 |
| Xiamen, CN | 5 |
| Monastir, TN | 5 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 5 |
| ESP109location not on record | 5 |
| CJBGlocation not on record | 5 |
| Sevilla, ES | 5 |
| GJOlocation not on record | 5 |
| Bronx, US | 4 |
| Bourges, FR | 4 |
| Lausanne, CH | 4 |
| Porrentruy, CH | 4 |
| GZUlocation not on record | 3 |
| PRClocation not on record | 3 |
| Vitoria, ES | 3 |
| Pamplona, ES | 3 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| JBCLMlocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Boumlocation not on record | 2 |
| Dresden, DE | 2 |
| Glarus, CH | 2 |
| Paris, FR | 2 |
| Frauenfeld, CH | 2 |
| Moscow State Universitylocation not on record | 2 |
| Gijón, ES | 2 |
| Boise, US | 2 |
| Saint Louis, US | 2 |
| Muséum Henri Lecoqlocation not on record | 1 |
| SNSNMClocation not on record | 1 |
| Durham, US | 1 |
| Sant Julià de Lòria, AD | 1 |
| Frankfurt am Main | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Denver, US | 1 |
| ESP003location not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Provincia di Livornolocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Pamplona, ES | 1 |
| New Brunswick, US | 1 |
| Görlitz, DE | 1 |
| Uppsala, SE | 1 |
| EEZA-CSIClocation not on record | 1 |
| Stockholm, SE | 1 |
| ULBF-AGRlocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
85 institutions · 1 205 of 1 255 vouchered records shown · 49 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA9 detections
Where the DNA of Scrophularia canina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found9
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 9 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.5 °C 12.4–24.2
Seasonal swing summer↔winter19.6 °C
Max temp (day)18.9 °C 17.3–31.4
Min temp (night)9.30 °C 6.30–16.2
Precipitation57.3 mm/mo 4.40–72.2
Air humidity56.3 % 43.8–58.3
Moisture balance-35.0 mm/mo -164–-20.6
Vapour deficit782 Pa 745–1,848
Wind speed2.60 m/s 2.60–4.30
Cloud cover37.6 % 22.6–40.9
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.