Scorzonera humilis
speciesAt a glance
Occurrence records112 153
Data sources13
Biological traits38
DNA specimens20
eDNA detections16
Sources13 archives
Databases and archives Scorzonera humilis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility112 153 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics20 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources38 traits
Chemical compositionLOTUS · NPASS25 compounds
Occurrence & distributionGBIF112 153 records
Environmental DNA2 datasets · 5 countries16 detections
DNA & barcodingBOLD · NCBI20 specimens
Genome at a glanceCCDB · GoaT6.9 Gbp
01Narrative
Scorzonera humilis, la Scorsonère des prés, Petite scorsonère ou Scorzonère humble, est une espèce de plante à fleurs de la famille des Astéracées (Composées).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass142 mg
Leaf size2 633 mm²
⚠ sources differ — LEDA: 2 633 mm² · GIFT: 2 975 mm²
Plant height0.25 m
⚠ sources differ — GIFT: 0.25 m · LEDA: 0.25 m · TRY: 0.277 m
Plant height generative0.28 m
Plant height max0.5 m
Plant height min0.05 m
Seed length8 mm
Seed mass4.07 mg
⚠ sources differ — TRY: 4.07 mg · LEDA: 3.51 mg · GIFT: 3.89 mg
Seed mass max5.18 mg
Seed mass min2.63 mg
Life cycle & reproduction14
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endJun
Flowering startMay
Life formperennial
Life spanperennial
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number2 947
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment7
Climatetemperate
Climberself-supporting
Fruit typeachene
Growth formherb
Habitat GIFTmeadows, shrubberies
Mycorrhiza type0.000000000179
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)178 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)18.29 mm²/mg
Other traits1
Diaspore typefruit
03Chemical composition25 compounds
Compounds documented for Scorzonera humilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Guaiane sesquiterpenoids9
Monomeric stilbenes9
Flavones2
Flavonols2
Furofuranoid lignans2
Documented compounds25 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-1-Hydroxypinoresinol 1-O-Beta-D-Glucopyranoside | present | LOTUS | |
| (-)-Chicoric acid | present | LOTUS | |
| (2S,3R,4S,5S,6R)-3,4,5-Trihydroxy-6-(hydroxymethyl)tetrahydro-2H-pyran-2-yl 4-(4-hydroxyphenethyl)benzofuran-2-carboxylate | present | LOTUS | |
| (3,9-Dimethyl-2,7-dioxo-4-sulfooxy-3,3a,4,5,9a,9b-hexahydroazuleno[4,5-b]furan-6-yl)methyl 3-methylbutanoate | present | LOTUS | |
| (3aS)-3a,4,5,6,6abeta,7,8,9,9abeta,9balpha-Decahydro-8alpha-(beta-D-glucopyranosyloxy)-3,6,9-tris(methylene)azuleno[4,5-b]furan-2(3H)-one | present | LOTUS | |
| (4-acetyloxy-3-methyl-6,9-dimethylidene-2-oxo-3a,4,5,6a,7,8,9a,9b-octahydro-3H-azuleno[4,5-b]furan-8-yl) acetate | present | LOTUS | |
| (4-Hydroxy-3,9-dimethyl-2,7-dioxo-3,3a,4,5,9a,9b-hexahydroazuleno[4,5-b]furan-6-yl)methyl 3-methylbutanoate | present | LOTUS | |
| 1-[2-[2-(4-hydroxyphenyl)ethyl]-3,6-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]phenyl]ethanone | present | LOTUS | |
| 1-[6-hydroxy-2-[2-(4-hydroxyphenyl)ethyl]-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]ethanone | present | LOTUS | |
| 5-hydroxy-3,6,10-trimethyl-9-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,8,9,11a-hexahydro-3H-cyclodeca[b]furan-2-one | present | LOTUS |
05DNA & barcoding20 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scorzonera humilis has left across the world's sequence archives.
At a glance
DNA specimens20
Marker genes6
GenBank sequences10
eDNA detections16
Countries7
The DNA barcodea real sequence read deposited for this species
TCGAAACCTGCCAAGCAGAACGACCCGTGAACTTGTACTCAAAATCAGGTGATGGGGTAACATTCCTAGGATTGGAACCCTGTTGCCTGT …
Scorzonera humilis voucher Scorzonera_humilis_2244 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★rbcLa★ITS3★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Scorzonera humilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size6 924 240 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Scorzonera humilis6.92 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–142n range14median14mode26records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1426×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · brit-fl +7
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · iber-fl — Karyology of the Scorzonera (Compositae) species from the Iberian Peninsula. Daz de la Guardia, C. & G. Blanca.Pl. Syst. Evol.156: 29-42(1987).
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 280-289. Castroviejo, S.Anales Jard. Bot. Madrid40(2): 457-462(1984).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3900
CCDB · fl-europaea — Fernandes & Queiros,
CCDB · ipcn-api-dl — Diaz de la Guardia, C. & G. Blanca. 1987. Karyology of the Scorzonera (Compositae) species from the Iberian peninsula. Pl. Syst. Evol. 156: 29–42.
CCDB · ipcn-api-dl — UOTILA, P. & K. Pellinen. 1985. Chromosome numbers in vascular plants from Finland. Acta Bot. Fenn. 130.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1987. Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23–33.
CCDB · ipcn-api-dl — Castroviejo, S. 1984. Numeros cromosomaticos de plantas occidentales, 280--289. Anales Jard. Bot. Madrid 40: 457–462.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.
CCDB · ipcn-api-dl — Dvorak, F. & B. Dadakova. 1977b. In IOPB chromosome number reports LVI. Taxon 26: 257–274.
CCDB · book-northern-plants — Wulff 1938. L. & L. 1944 b.
CCDB · book-atlas-flowering-plants — Wulff 1938
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Dmitrieva, S. A. (1987). Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23-33.
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1988a). Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika.
Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfe
CCDB · CromoCat 2015 — Castroviejo, S. (1984). Números cromosomáticos de plantas occidentales, 280-289. Anales Jard. Bot. Madrid 40(2): 457-462.
CCDB · CromoCat 2015 — Díaz de la Guardia, C. & Blanca, G. (1987). Karyology of the Scorzonera (Compositae) species from the Iberian Peninsula. Pl. Syst. Evol. 156: 29-42.
CCDB · CromoCat 2015 — Dvorak, F. & Dadakova, B. (1977b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVI]. Taxon 26(2/3): 257-258.
CCDB · CromoCat 2015 — Dvo?ák, F., Dadáková, B. & R?ži?ka, I. (1979). Chromosome morphology of the Czechoslovak species of the genus Scorzonera. Folia Geobot. Phytotax. 14: 185-199
CCDB · CromoCat 2015 — Kerguélen, M. (1998). Index synonymique de la Flore de France INRA-MNHN Dijon
2n 152×CCDB · fl-europaea · CCDB · CromoCat 2015
CCDB · fl-europaea — Fernandes & Queiros,
CCDB · CromoCat 2015 — Kerguélen, M. (1998). Index synonymique de la Flore de France INRA-MNHN Dijon
n 03×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Dmitrieva, S. A. (1987). Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23-33.
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1988a). Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika.
Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfe
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type112 153 records
Wild obs. + sensor107 374
Museum / vouchered4 540
Cultivated / captive9
Other230
Origin
Native117
Introduced2
Range
Area of Occupancy AOO134 380 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy51% within 1 km
≤100 m 34 082≤1 km 7 497≤10 km 40 195>10 km 469
82 243 georeferenced · 25 131 without coordinates
Open the mapobservation + sensor107 374
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy33% within 1 km
≤100 m 305≤1 km 670≤10 km 1 952>10 km 46
2 973 georeferenced · 1 567 without coordinates
Open the institutions mapphysical evidence4 540
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 5
6 georeferenced · 3 without coordinates
Open the mapnot free-living9
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions51 of 119 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 674 |
| BFLlocation not on record | 364 |
| LDlocation not on record | 302 |
| SLU Artdatabankenlocation not on record | 157 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 152 |
| Oskarshamn, SE | 146 |
| Olocation not on record | 144 |
| BRNUlocation not on record | 127 |
| Moscow State Universitylocation not on record | 127 |
| Tartu, EE | 106 |
| LfUlocation not on record | 74 |
| Adam Mickiewicz University in Poznańlocation not on record | 70 |
| Salzburg, AT | 66 |
| Zürich, CH | 55 |
| Tallinn, EE | 43 |
| Zürich, CH | 42 |
| CJBGlocation not on record | 39 |
| Bern, CH | 36 |
| Görlitz, DE | 34 |
| Mlocation not on record | 31 |
| BIO-UNIPIlocation not on record | 26 |
| Turku, FI | 25 |
| BClocation not on record | 24 |
| Vitoria, ES | 21 |
| Uppsala, SE | 21 |
| South Kensington, GB | 20 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 20 |
| Provincia di Livornolocation not on record | 17 |
| San Sebastián, ES | 17 |
| No collectionlocation not on record | 16 |
| Dresden, DE | 16 |
| Trondheim, NO | 16 |
| Wlocation not on record | 16 |
| Barcelona, ES | 14 |
| Uniwersytet Warszawskilocation not on record | 14 |
| Oulu, FI | 13 |
| València, ES | 12 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 11 |
| Bergen, NO | 11 |
| Brussel, BE | 9 |
| BDBClocation not on record | 9 |
| KMNlocation not on record | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 7 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 6 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 6 |
| MAlocation not on record | 6 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| PrivatHerblocation not on record | 5 |
| SZUlocation not on record | 5 |
| Jyväskylä, FI | 5 |
| GJOlocation not on record | 4 |
| Karlsruhe, DE | 4 |
| Philadelphia, US | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| PRClocation not on record | 4 |
| Québec, CA | 4 |
| H-Adlerlocation not on record | 4 |
| Pamplona, ES | 4 |
| OLAlocation not on record | 4 |
| DBF-NHMDlocation not on record | 4 |
| NMBU:MINAlocation not on record | 4 |
| Salamanca, ES | 3 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 3 |
| CICYTEXlocation not on record | 3 |
| Porvoo, FI | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| Berlin, DE | 3 |
| LIVlocation not on record | 3 |
| Forssa, FI | 3 |
| Paris, FR | 3 |
| GZUlocation not on record | 3 |
| Kuopio, FI | 2 |
| TROMlocation not on record | 2 |
| Monastir, TN | 2 |
| MeiseBGlocation not on record | 2 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Porrentruy, CH | 2 |
| Pamplona, ES | 2 |
| H-Schuhwlocation not on record | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| Namur, BE | 2 |
| Stockholm, SE | 2 |
| Bourges, FR | 2 |
| CJBNlocation not on record | 2 |
| Alicante, ES | 2 |
| Frauenfeld, CH | 2 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 2 |
| BMlocation not on record | 1 |
| Beijing, CN | 1 |
| NMWlocation not on record | 1 |
| Göteborg, SE | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 1 |
| BM|OXFlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Bronx, US | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Lausanne, CH | 1 |
| ISAlocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Bangkok, TH | 1 |
| Saint Louis, US | 1 |
| National Museum Waleslocation not on record | 1 |
| Xiamen, CN | 1 |
| Tula State Universitylocation not on record | 1 |
| nbflocation not on record | 1 |
| Sion, CH | 1 |
| FLADlocation not on record | 1 |
| Kew, GB | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Bloomington, US | 1 |
| Helsinki, FI | 1 |
| NTNU University Museum, Department of Natural Historylocation not on record | 1 |
| Sevilla, ES | 1 |
119 institutions · 4 341 of 4 540 vouchered records shown · 161 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA16 detections
Where the DNA of Scorzonera humilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found16
Studies independent surveys2
Countries5
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 16 detections have coordinates
Open the map5 countries0
Growing in beds on Partere
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median10.6 °C 8.30–17.1
Seasonal swing summer↔winter21.7 °C
Max temp (day)14.2 °C 12.7–19.1
Min temp (night)7.90 °C 3.50–14.6
Precipitation60.7 mm/mo 40.6–79.7
Air humidity61.1 % 57.3–64.7
Moisture balance-43.5 mm/mo -56.8–11.5
Vapour deficit533 Pa 448–744
Wind speed3.20 m/s 2.20–4.20
Cloud cover43.4 % 37.9–48.6
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.