Scorias spongiosa

(Schwein.) Fr. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Capnodiales/Capnodiaceae/Scorias

At a glance

Occurrence records3 804

Data sources7

Biological traits0

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Scorias spongiosa's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility3 804 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 804 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI≈24 Mbp

01Narrative

Scorias spongiosa is a sooty mould fungus that grows on aphid honeydew. It is a member of the Capnodiaceae family of ascomycete fungi. It is found only on American beech trees, Fagus grandifolia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scorias spongiosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences9

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKY592166.1 ↗203 bp

ACGT

TTACACCAATCAAGCCTCGCTTGGTATTGGGCGATGCGGCGGCCTTTTGTCCCCCGCACGCCTCAAATTCGACCGGCCGAGCCGTCTCGT …

Scorias spongiosa clone G-fon3-ITS2_OTU-0-364_2 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Scorias spongiosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈24 218 186 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Scorias spongiosa0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness89.2% BUSCO

08Occurrence & distribution

Record type3 804 records

Wild obs. + sensor3 539

Museum / vouchered256

Other9

Range

Area of Occupancy AOO8 248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 879≤1 km 503≤10 km 253>10 km 191

2 826 georeferenced · 713 without coordinates

Open the mapobservation + sensor3 539

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤1 km 43≤10 km 141>10 km 40

224 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence256

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	114
Catholic University of Pekinglocation not on record	25
Madison, US	15
PHlocation not on record	14
ILLSlocation not on record	11
Chapel Hill, US	8
TENN-Flocation not on record	8
FLASlocation not on record	7
Blacksburg, US	7
McWane Science Centerlocation not on record	6
Champaign, US	5
Pullman, US	4
Toronto, CA	4
Durham, US	4
Cincinnati, US	3
Chicago, US	3
Bronx, US	3
Auckland, NZ	2
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	2
Lincoln, US	1
Museo Entomologico de Leonlocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
Karlsruhe, DE	1
Laramie, US	1
CA	1
WTUlocation not on record	1
Brown Universitylocation not on record	1
Clemson, US	1

28 institutions · 254 of 256 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Scorias spongiosa

At a glance

Sources7 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 804 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 28 geolocated

Record type3 804 records