Scoparia pyralella

Hübner, 1796 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Scoparia

At a glance

Occurrence records3 516

Data sources8

Biological traits0

DNA specimens102

eDNA detections124

Sources8 archives

Databases and archives Scoparia pyralella's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 516 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI124 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics102 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 516 records

Environmental DNA3 datasets · 10 countries124 detections

DNA & barcodingBOLD102 specimens

Genome at a glanceGoaT · NCBI≈947 Mbp

01Narrative

De oranje granietmot is een vlinder uit de familie grasmotten (Crambidae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding102 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scoparia pyralella has left across the world's sequence archives.

At a glance

DNA specimens102

BINs5

Marker genes1

eDNA detections124

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus96 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

22Tmostly conserved

40Amostly conserved

43Gmostly conserved

88Cmostly conserved

124Cmostly conserved

166Amostly conserved

287Cmostly conserved

307Amostly conserved

343Tmostly conserved

433Gmostly conserved

466Gmostly conserved

478Amostly conserved

514Cmostly conserved

517Amostly conserved

547Amostly conserved

616Cmostly conserved

628Gmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGGACTTCTTTAAGATTACTTATTCGAGCTGAATTAGGAGCTCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.97%

Haplotypes24

BINs5

Most divergent pair3.6%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Scoparia staudingeralissame genus3.5%Scoparia conicellasame genus4.9%Scoparia ingratellasame genus5.6%Scoparia basistrigalissame genus6.2%Scoparia ambigualissame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Scoparia pyralella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈946 904 500 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Scoparia pyralella0.95 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97% BUSCO

08Occurrence & distribution

Record type3 516 records

Wild obs. + sensor3 042

Museum / vouchered474

Range

Area of Occupancy AOO5 508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 1 479≤1 km 597≤10 km 439>10 km 29

2 544 georeferenced · 498 without coordinates

Open the mapobservation + sensor3 042

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 330≤1 km 17≤10 km 102

449 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence474

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	425
ZSMlocation not on record	1
University of Vienna, Dept of Botany and Biodiversity Researchlocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Natural History Museum, Londonlocation not on record	1
Research Collection of Alfred Haslbergerlocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1

8 institutions · 432 of 474 vouchered records shown · 42 without an institution code

09Environmental DNA124 detections

Where the DNA of Scoparia pyralella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found124

Studies independent surveys3

Countries10

Verifiable raw sequence linked47

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 124 detections have coordinates

Open the map10 countries0

dry grasslandUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 11.9–17.7

Seasonal swing summer↔winter18.3 °C

Max temp (day)18.7 °C 14.2–21.8

Min temp (night)10.9 °C 7.50–13.8

Precipitation73.2 mm/mo 42.2–129

Air humidity59.6 % 57.1–62.4

Moisture balance-48.9 mm/mo -88.5–6.90

Vapour deficit683 Pa 522–828

Wind speed3.30 m/s 2.20–5.30

Cloud cover39.8 % 35.0–51.7

CHELSA 1981–2010, ~9 km grid, at location & month of 121 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Scoparia pyralella

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 516 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 516 records