Scoparia dulcis
speciesAt a glance
Occurrence records12 200
Data sources13
Biological traits40
DNA specimens32
eDNA detections17
Sources13 archives
Databases and archives Scoparia dulcis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility12 200 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics32 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources40 traits
Chemical compositionLOTUS · NPASS95 compounds
Occurrence & distributionGBIF12 200 records
Environmental DNA1 datasets · 5 countries17 detections
DNA & barcodingBOLD · NCBI32 specimens
Genome at a glanceCCDB2n = 40
01Narrative
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology18
Fruit length3 mm
⚠ sources differ — AusTraits: 3 mm · GIFT: 2.5 mm
Fruit length max3 mm
Fruit length min2 mm
Fruit width2.5 mm
Fruit width max3 mm
Fruit width min2 mm
Leaf length2.8 mm
⚠ sources differ — AusTraits: 2.8 mm · GIFT: 35 mm
Leaf length max3.6 mm
Leaf length min2 mm
Leaf width11.25 mm
⚠ sources differ — AusTraits: 11.25 mm · GIFT: 15 mm
Leaf width max15 mm
Leaf width min7.5 mm
Plant height0.8 m
⚠ sources differ — GIFT: 0.8 m · AusTraits: 0.825 m · TRY: 0.6 m
Plant height max1 m
Plant height min0 m
Seed mass0.01 mg
Seed mass max0.01 mg
Seed mass min0.01 mg
Life cycle & reproduction8
Deciduousnessevergreen
Dispersal typewater
Flowering endMar
Flowering startMar
Flowering timeyyyyyynnnnnn
Life formannual or subshrub
Life spanannual/perennial
⚠ sources differ — TRY: annual/perennial · AusTraits: annual · GIFT: perennial
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campinarana, Campo de Altitude, Campo de Várzea, Campo Limpo, Campo Rupestre, Carrasco, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta de Igapó, Floresta de Terra Firme, Floresta de Várzea, Floresta Es
Leaf shapelanceolate ovate rhomboidal
Woodinessvariable
⚠ sources differ — TRY: non-woody/woody · AusTraits: herbaceous · GIFT: non-woody
Physiology & chemistry1
Nitrogen fixingnon_nitrogen_fixer
03Chemical composition95 compounds
Compounds documented for Scoparia dulcis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavones41
Podocarpane diterpenoids22
Labdane diterpenoids17
Cinnamic acids and derivatives4
Flavonols3
Documented compounds95 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,2R,6R,7S,8S,10R,13R)-8-benzoyloxy-6-(hydroxymethyl)-2,13-dimethyl-12-oxotetracyclo[11.2.1.01,10.02,7]hexadecane-6-carboxylic acid | present | LOTUS | |
| (1R,4aR,5R,8R,8aR)-8-(Benzoyloxy)decahydro-5-((3E)-5-hydroxy-3-methyl-3-penten-1-yl)-1,4a-dimethyl-6-methylene-1-naphthalenecarboxylic acid | present | LOTUS | |
| (1R,4aR,5R,8S,8aR)-8-hydroxy-5-(2-hydroxyethyl)-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | LOTUS | |
| (1R,4aS,5S,6R,7R,8S,8aR)-7-acetyloxy-8-benzoyloxy-5-[(E)-5-hydroxy-3-methylpent-3-enyl]-1,4a-dimethylspiro[3,4,5,7,8,8a-hexahydro-2H-naphthalene-6,2'-oxirane]-1-carboxylic acid | present | LOTUS | |
| (1S,2S,6S,7R,8R,10R,12S,13S)-8-benzoyloxy-12-hydroxy-2,6,13-trimethyltetracyclo[11.2.1.01,10.02,7]hexadecane-6-carboxylic acid | present | LOTUS | |
| (1S,2S,6S,7R,8R,10S,13S)-8-benzoyloxy-2,6,13-trimethyl-12-oxotetracyclo[11.2.1.01,10.02,7]hexadecane-6-carboxylic acid | present | LOTUS | |
| (1S,2S,6S,7R,8R,10S,13S)-8-benzoyloxy-6-(hydroxymethyl)-2,13-dimethyl-12-oxotetracyclo[11.2.1.01,10.02,7]hexadecane-6-carboxylic acid | present | LOTUS | |
| (1S,4aR,5S,7S,8S,8aR)-7-acetyloxy-8-benzoyloxy-5-[(E)-5-hydroxy-3-methylpent-3-enyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | LOTUS | |
| (1S,4aR,5S,7S,8S,8aR)-8-benzoyloxy-7-hydroxy-5-[(E)-5-hydroxy-3-methylpent-3-enyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | LOTUS | |
| (2S)-5-hydroxy-6,7-dimethoxy-2-[4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-2,3-dihydrochromen-4-one | present | LOTUS |
05DNA & barcoding32 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scoparia dulcis has left across the world's sequence archives.
At a glance
DNA specimens32
Marker genes6
GenBank sequences10
eDNA detections17
Countries6
The DNA barcodea real sequence read deposited for this species
CGGATCGCGGCGACGTGAGCGGTTCGCTGCCCGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACA …
Scoparia dulcis voucher Scatigna, A.V. 102 (UEC) 18S small subunit ribosomal RNA gene and internal transcribed spacer 1, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK3★rbcL4★rbcLa★ITS3★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Scoparia dulcis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidypolyploid inferred
Chromosome records20–402n range40median40mode8records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 405×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · ipcn-api-dl — Subramanian, D. & R. Pondmudi. 1987. Cytotaxonomical studies of south Indian Scrophulariaceae. Cytologia 52: 529–541.
CCDB · book-indian_vol1 — Raghavan, T.S. & Srinivasan, V.K. 1940b; Chuang, T.J. et al. 1963; Bhatta- charyya, N.K. 1967
CCDB · book-fedorov — Raghavan T. S., Srinivasan V. K. 1940b
CCDB · book-fedorov — Chuang et al. 1963
CCDB · book-fedorov — I. 1963)
2n 203×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · ipcn-api-dl — Trivedi, M. P. & V. Thakur. 1982. Meiotic studies in three natural populations of Scoparia dulcis L. Proc. Indian Sci. Congr. Assoc. 69(3–VI): 241–242.
CCDB · book-indian_vol1 — Lewis, W.H. et al. 1962; Baquar, S.R. 1967-1968; Sarkar, A.K. et al. 1973a ; Gill, L.S. 1978b
CCDB · book-fedorov — Lewis W. H. et al. 1962
n 207×CCDB · ipcn-api-dl · CCDB · Cave1963
CCDB · ipcn-api-dl — Trivedi, M. P. & R. N. Trivedi. 1983. Cytogenetical studies of weeds of Bihar I. Proc. Indian Sci. Congr. Assoc. 70(3–VI): 91–92.
CCDB · ipcn-api-dl — Trivedi, M. P. 1984. Cytogenetics of some exotic weeds. Proc. Indian Sci. Congr. Assoc. 71(3–VI): 72.
CCDB · ipcn-api-dl — Trivedi, R. N. & M. P. Trivedi. 1985. Induced meiotic anomalies by 2,4D in Scoparia dulcis L. Proc. Indian Sci. Congr. Assoc. 72(3–VI): 146.
CCDB · ipcn-api-dl — Subramanian, D. & R. Pondmudi. 1987. Cytotaxonomical studies of south Indian Scrophulariaceae. Cytologia 52: 529–541.
CCDB · ipcn-api-dl — Chandran, R. & K. V. Bhavanandan. 1983. In IOPB chromosome numbers reports LXXIX. Taxon 32: 320.
CCDB · ipcn-api-dl — Trivedi, M. P. & R. N. Trivedi. 1992. Chromosomal behaviour in weeds. Glimpses Cytogenet. India 3: 188–198.
CCDB · Cave1963 — Chuang et al. 1963
n 104×CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 · CCDB · Cave1962
CCDB · book-ipcn67-71 — BAQUAR, S.R. 1967-68. Chromosome numbers in some vascular plants of East Pakistan. Rev. Biol. 6: 440-448.
CCDB · book-ipcn75-78 — Gill l 978c
CCDB · book-ipcn75-78 — Gill l 978a
CCDB · Cave1962 — Lewis et al. 1962
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type12 200 records
Wild obs. + sensor5 062
Museum / vouchered7 058
Cultivated / captive2
Other78
Origin
Native1 096
Introduced27
Range
Area of Occupancy AOO31 664 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy86% within 1 km
≤100 m 2 445≤1 km 410≤10 km 228>10 km 251
3 334 georeferenced · 1 728 without coordinates
Open the mapobservation + sensor5 062
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy57% within 1 km
≤100 m 611≤1 km 168≤10 km 437>10 km 152
1 368 georeferenced · 5 690 without coordinates
Open the institutions mapphysical evidence7 058
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 2 records without
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions163 of 382 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 812 |
| Bronx, US | 264 |
| Brisbane, AU | 258 |
| Durango, MX | 215 |
| Kew, GB | 143 |
| Forest Herbarium Ibadan (FHI)location not on record | 140 |
| UNIVASFlocation not on record | 128 |
| Tampa, US | 115 |
| University of Stellenboschlocation not on record | 110 |
| MeiseBGlocation not on record | 110 |
| National Biodiversity Institute, Costa Ricalocation not on record | 109 |
| Mexico City, MX | 107 |
| Mexico City, MX | 97 |
| Palmerston, AU | 85 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 84 |
| Universidad Nacional de Colombia (UNAL)location not on record | 79 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 78 |
| Laboratorio de Ictiologialocation not on record | 76 |
| Paleontological Collectionlocation not on record | 75 |
| Chaguaramas, TT | 74 |
| Instituto do Meio Ambientelocation not on record | 64 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 63 |
| Taipei, TW | 59 |
| Universidad de Antioquia (UdeA)location not on record | 59 |
| Museo Entomologico de Leonlocation not on record | 56 |
| Masindi, UG | 52 |
| Canberra, AU | 52 |
| UNICAMPlocation not on record | 49 |
| Universidade Federal do Maranhãolocation not on record | 47 |
| Kunming, CN | 46 |
| Smithfield, AU | 45 |
| UFBAlocation not on record | 44 |
| Universidade Federal de Sergipe (UFS)location not on record | 43 |
| Feira de Santana, BR | 42 |
| Castelar, AR | 42 |
| Austin, US | 42 |
| Yaoundé, CM | 41 |
| UFMSlocation not on record | 40 |
| JBRJlocation not on record | 40 |
| Corrientes, AR | 39 |
| León, NI | 38 |
| Puerto Ayora, EC | 37 |
| Miami, US | 37 |
| Departamento de Sistematica e Ecologialocation not on record | 36 |
| HNBlocation not on record | 36 |
| Beijing, CN | 35 |
| WAGlocation not on record | 33 |
| Plocation not on record | 33 |
| Guangzhou, CN | 32 |
| Xiamen, CN | 31 |
| Antiguo Cuscatlán, SV | 31 |
| San Isidro, AR | 30 |
| Blumenau, BR | 30 |
| Altos de Pipe, VE | 29 |
| LBVlocation not on record | 28 |
| Herbier National du Gabonlocation not on record | 28 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 28 |
| Universidad de Nariño (UdeNar)location not on record | 27 |
| Taipei, TW | 27 |
| Baroda, IN | 26 |
| USP-IBlocation not on record | 26 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 25 |
| Berlin, DE | 25 |
| UFRPElocation not on record | 25 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 24 |
| Campo Grande, BR | 24 |
| TAIElocation not on record | 24 |
| Leiden University Medical Centerlocation not on record | 24 |
| Brasília, BR | 24 |
| Museu Paraense Emílio Goeldilocation not on record | 23 |
| UFPElocation not on record | 23 |
| UEMAlocation not on record | 22 |
| PUC-RSlocation not on record | 22 |
| UFESlocation not on record | 22 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 21 |
| Tuxtla Gutiérrez, MX | 21 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 21 |
| UnBlocation not on record | 21 |
| Cenargenlocation not on record | 20 |
| Durham, US | 20 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 20 |
| Ivano-Frankivsk, UA | 20 |
| Culiacán, MX | 20 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 19 |
| Federal University of Espírito Santolocation not on record | 19 |
| CEPLAClocation not on record | 19 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 18 |
| Fort Worth, US | 18 |
| Brasília, BR | 18 |
| Salvador, BR | 17 |
| Wuzhou, CN | 17 |
| Loja, EC | 17 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 17 |
| Riverside, US | 17 |
| Fortaleza, BR | 16 |
| Guilin, CN | 16 |
| Istituto Agrario Castelnuovolocation not on record | 15 |
| Frankfurt am Main | 15 |
| Université du Lomélocation not on record | 15 |
| UFERSAlocation not on record | 15 |
| Stockholm, SE | 15 |
| UEPAlocation not on record | 15 |
| US | 14 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 14 |
| Glocation not on record | 14 |
| Cuiabá, BR | 14 |
| MAlocation not on record | 14 |
| Valdosta State Universitylocation not on record | 13 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 13 |
| Universidad Industrial de Santander (UIS)location not on record | 13 |
| Santa Cruz de la Sierra, BO | 13 |
| Autlán de Navarro, MX | 13 |
| CPATSAlocation not on record | 12 |
| Chongqing Museumlocation not on record | 12 |
| Taipei, TW | 12 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 12 |
| Mérida, MX | 12 |
| Aarhus, DK | 11 |
| Bangkok, TH | 11 |
| IECOSlocation not on record | 11 |
| Universidad de Caldas (UCaldas)location not on record | 11 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 11 |
| Guasave, MX | 11 |
| Universidade Federal de Goiáslocation not on record | 10 |
| Mount Annan, AU | 10 |
| Pondicherry, IN | 10 |
| Bloomington, US | 10 |
| CJBGlocation not on record | 10 |
| Austin, US | 10 |
| IPA/SPlocation not on record | 10 |
| Chapingo, MX | 9 |
| Universidad Nacional de Asunciónlocation not on record | 9 |
| Jackson, US | 9 |
| LSF/FSA/UAClocation not on record | 9 |
| Area de Conservacion Guanacastelocation not on record | 9 |
| FUVATESlocation not on record | 9 |
| Paris, FR | 9 |
| James Cook Townsvillelocation not on record | 9 |
| Pretoria, ZA | 9 |
| San José, CR | 9 |
| Kensington, AU | 9 |
| Chicago, US | 9 |
| Nanjing, CN | 9 |
| BAYLUlocation not on record | 8 |
| San Diego, US | 8 |
| ESALQlocation not on record | 8 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 8 |
| UFOPlocation not on record | 8 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 8 |
| Tapachula, MX | 8 |
| CNF-UFHBlocation not on record | 8 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 8 |
| Adelaide, AU | 8 |
| Kathmandu, NP | 8 |
| Jena Microbial Resource Collectionlocation not on record | 8 |
| QCNElocation not on record | 7 |
| La Paz, MX | 7 |
| Universidade de São Paulolocation not on record | 7 |
| Durban, ZA | 7 |
| Moscow State Universitylocation not on record | 7 |
| ASUlocation not on record | 7 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 7 |
| URCAlocation not on record | 6 |
| UNESP-FCAlocation not on record | 6 |
| La Paz, BO | 6 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 6 |
| Elocation not on record | 6 |
| UNESClocation not on record | 6 |
| Córdoba, AR | 6 |
| South Kensington, GB | 6 |
| UFSClocation not on record | 6 |
| Columbia, US | 6 |
| Tuscaloosa, US | 5 |
| Bogotá, D.C., CO | 5 |
| Londrina, BR | 5 |
| Tuxtla Gutiérrez, MX | 5 |
| Chapel Hill, US | 5 |
| Criciúma, BR | 5 |
| San Francisco, US | 5 |
| Universidad de los Andes (UniAndes)location not on record | 5 |
| Sucre, BO | 5 |
| Madison, US | 5 |
| Riobamba, EC | 5 |
| GAlocation not on record | 5 |
| HACAMlocation not on record | 5 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 5 |
| Universidad de La Salle (La Salle)location not on record | 5 |
| EL PASO, US | 5 |
| San Francisco de Campeche, MX | 4 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| Knoxville, US | 4 |
| Wlocation not on record | 4 |
| UFPIlocation not on record | 4 |
| UTFPR-CPlocation not on record | 4 |
| Cruz das Almas, BR | 4 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 4 |
| Armidale, AU | 4 |
| Brooklyn Botanic Gardenlocation not on record | 4 |
| AUAlocation not on record | 4 |
| Jataí / Setor Industrial, BR | 4 |
| UNEMATlocation not on record | 4 |
| LSFlocation not on record | 4 |
| BMlocation not on record | 4 |
| UEMlocation not on record | 4 |
| INMAlocation not on record | 4 |
| UFVJMlocation not on record | 4 |
| National Institute of Biological Resourceslocation not on record | 4 |
| Brussels, BE | 3 |
| EAlocation not on record | 3 |
| Universidade Federal de Santa Catarinalocation not on record | 3 |
| FJIDClocation not on record | 3 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 3 |
| Cibinong Science Center, Herbarium Bogorienselocation not on record | 3 |
| Toyota city nature sanctuarylocation not on record | 3 |
| Burlington, US | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| Universiti Sains Malaysialocation not on record | 3 |
| UFPRlocation not on record | 3 |
| Clocation not on record | 3 |
| Wuhan, CN | 3 |
| Guatemala City, GT | 3 |
| Ural Federal University "B. N. Yeltsin"location not on record | 3 |
| Yangling, CN | 3 |
| Hanshan Normal Universitylocation not on record | 3 |
| Cochabamba, BO | 3 |
| HUAlocation not on record | 3 |
| Claremont, US | 3 |
| UFMGlocation not on record | 3 |
| UTPLlocation not on record | 3 |
| Cambridge, US | 3 |
| UNESP-RClocation not on record | 3 |
| Montréal, CA | 3 |
| Cusco, PE | 3 |
| OTSlocation not on record | 2 |
| COLlocation not on record | 2 |
| Universidade Federale do Rio Grande do Sullocation not on record | 2 |
| Quito, EC | 2 |
| Campo Mourão, BR | 2 |
| Mississippi State, US | 2 |
| UNITINSlocation not on record | 2 |
| València, ES | 2 |
| Barcelona, ES | 2 |
| FPMZBlocation not on record | 2 |
| Ilhéus, BR | 2 |
| Auckland, NZ | 2 |
| Edinburgh, GB | 2 |
| Calabar, NG | 2 |
| Universidad de Córdoba (UC)location not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| Nishihara, JP | 2 |
| Albuquerque, US | 2 |
| Cascavel, BR | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| LISClocation not on record | 2 |
| 黔东南州民族医药研究所标本室location not on record | 2 |
| Shanghai, CN | 2 |
| UEGlocation not on record | 2 |
| Changsha, CN | 2 |
| Universidad Nacional Agrarialocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Davis, US | 2 |
| Université National du Béninlocation not on record | 2 |
| Philadelphia, US | 2 |
| Phoenix, US | 2 |
| CASlocation not on record | 2 |
| BRLUlocation not on record | 2 |
| MEXUlocation not on record | 2 |
| La Trobe Universitylocation not on record | 2 |
| Jinghong, CN | 2 |
| Ciudad de México, MX | 2 |
| Centre National de Semences Forestièreslocation not on record | 2 |
| Awka, NG | 2 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 1 |
| GENTlocation not on record | 1 |
| Salamanca, ES | 1 |
| Botanical Garden "Anastasie Fatu" of Iasilocation not on record | 1 |
| Limbe Botanical & Zoological Gardenslocation not on record | 1 |
| Cincinnati, US | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record | 1 |
| Sangmiung Universitylocation not on record | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| HUT Culture Collectionlocation not on record | 1 |
| Université de Bordeauxlocation not on record | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| The CB Rhizobium Collectionlocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Botanic Gardenlocation not on record | 1 |
| Juriquilla, MX | 1 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 1 |
| UNISANTAlocation not on record | 1 |
| Dehra Dun, IN | 1 |
| UTFPR-DVlocation not on record | 1 |
| Yunnan Universitylocation not on record | 1 |
| South China Normal Universitylocation not on record | 1 |
| FJFClocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| University of Oklahomalocation not on record | 1 |
| Nanjing, CN | 1 |
| nlocation not on record | 1 |
| Vietnam Academy of Science and Technology (VAST)location not on record | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| Guangzhou, CN | 1 |
| Ensenada, MX | 1 |
| Arequipa, PE | 1 |
| Foz do Iguaçu, BR | 1 |
| Sanda, JP | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Alcaldía Municipal de Garzón en Huilalocation not on record | 1 |
| Managua, NI | 1 |
| Centro de Biotecnologia e Quimica-CEBIQlocation not on record | 1 |
| Forestry Research Institute of Nigerialocation not on record | 1 |
| Hobart, AU | 1 |
| Cambridge, US | 1 |
| MSB-3054location not on record | 1 |
| DEAL Martiniquelocation not on record | 1 |
| Universidad de Córdoba (UniCórdoba)location not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Universidad del Tolima (UT)location not on record | 1 |
| U. Molau (GB), 1991.location not on record | 1 |
| Berea Collegelocation not on record | 1 |
| Santarém, BR | 1 |
| Toronto, CA | 1 |
| Provo, US | 1 |
| Institut Botanique Ake-Assi d'Andokoilocation not on record | 1 |
| Coimbra, PT | 1 |
| DSMlocation not on record | 1 |
| UNICAPlocation not on record | 1 |
| CMULlocation not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| University of Oxfordlocation not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Department of Microbiology, Faculty of Sciencelocation not on record | 1 |
| Budapest, HU | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| Chengdu, CN | 1 |
| UFABClocation not on record | 1 |
| Salta, AR | 1 |
| UFSJlocation not on record | 1 |
| Seychelles National Herbariumlocation not on record | 1 |
| Millersville, US | 1 |
| Clemson, US | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| Universidad Nacional de Misiones- CONICETlocation not on record | 1 |
| Pittsburg, US | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| IPHAMETRAlocation not on record | 1 |
| MEDELlocation not on record | 1 |
| MUFALlocation not on record | 1 |
| IFANlocation not on record | 1 |
| Río Palenque Science Centerlocation not on record | 1 |
| Dekalb, US | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Chadron, US | 1 |
| Christchurch, NZ | 1 |
| College Park, US | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Vancouver, CA | 1 |
| CUVClocation not on record | 1 |
| Durham, US | 1 |
| Minia, EG | 1 |
| Universidade Federal do Oeste da Bahialocation not on record | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| Lake Charles, US | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Florida Museum of Natural Historylocation not on record | 1 |
| Due West, US | 1 |
| Fundación Miguel Lillolocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Instituto de Investigação Científica Tropicallocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Pelotas, BR | 1 |
| Honolulu, US | 1 |
| Universität Göttingenlocation not on record | 1 |
| Montpellier, FR | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| UESBlocation not on record | 1 |
382 institutions · 6 666 of 7 058 vouchered records shown · 391 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA17 detections
Where the DNA of Scoparia dulcis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.3 °C 23.1–26.1
Seasonal swing summer↔winter2.40 °C
Max temp (day)29.2 °C 25.5–29.6
Min temp (night)22.2 °C 21.0–22.6
Precipitation267 mm/mo 214–325
Air humidity68.1 % 64.4–73.2
Moisture balance117 mm/mo 66.9–167
Vapour deficit1,080 Pa 756–1,197
Wind speed2.30 m/s 1.30–3.40
Cloud cover30.5 % 21.7–52.3
CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.