Scolymus maculatus

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Scolymus

At a glance

Occurrence records4 718

Data sources12

Biological traits47

DNA specimens4

eDNA detections4

Sources12 archives

Databases and archives Scolymus maculatus's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 718 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources47 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF4 718 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Scolymus maculatus is a spiny annual plant in the family Asteraceae, native to the Mediterranean region in southern Europe, southwest Asia, and northern Africa, and also the Canary Islands. It has pinnately incised prickly leaves and prickly wings along the stems, both with a white marginal vein. The yellow flowerheads stand solitary or with a few together at the tip to the stems, and subtended by more than five leaflike bracts. The plant is known as scolyme taché in French, cardogna macchiata in Italian, cardo borriquero in Spanish, and escólimo-malhado in Portuguese, חוח עקוד in Hebrew and سنارية حولية in Arabic. In English it is called spotted golden thistle or spotted oyster thistle.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length3.25 mm

Fruit length max5.5 mm

Fruit length min4 mm

Leaf length120 mm

Leaf length max200 mm

Leaf length min40 mm

Leaf width50 mm

Leaf width max80 mm

Leaf width min20 mm

Plant height1 m

⚠ sources differ — AusTraits: 1 m · TRY: 0.95 m

Plant height generative0.684 m

Plant height max1 m

Plant height min0.15 m

Seed mass2.17 mg

⚠ sources differ — TRY: 2.17 mg · GIFT: 1.54 mg

Seed mass max1.54 mg

Seed mass min1.54 mg

Life cycle & reproduction8

Dehiscenceindehiscent

Flower colourblack

Flowering endOct

Flowering startJul

Flowering timennnnnnnnnnny

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit typeachene

Growth formherb

Habitat GIFTgarden

Leaf compoundnesssimple

Leaf formpinnatifid

Leaf shapelanceolate oblanceolate oblong

Woodinessnon-woody

Physiology & chemistry6

Leaf C:N ratio15.16 g/g

Leaf c353 mg/g

Leaf dry-matter content (LDMC)75.15 mg/g

Leaf n25.96 mg/g

Leaf p6.59 mg/g

Specific leaf area (SLA)34.74 mm²/mg

Other traits3

Defenseyes

Leaf arrangementalternate

Shoot orientationerect

03Chemical composition4 compounds

Compounds documented for Scolymus maculatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavones2

Flavonols2

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Apigenin	present	LOTUS
Kaempferol	present	LOTUS
Luteolin 7-diglucoside	present	LOTUS
Quercetin	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scolymus maculatus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences8

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH728943.1 ↗222 bpMorocco

ACGT

ATCGCGTCGCTCCCCCACCCTTCCCGTAAGGGAAATCATGGTGTCGGGGCGGAGATTGGCCTCCCGTTCCAATGGTGCGGTTGGCCCAAA …

Scolymus maculatus isolate A899 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Scolymus maculatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode18records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2018×CCDB · ita-fl · CCDB · iber-fl · CCDB · ipcn-api-dl +6

CCDB · ita-fl — BRULLO S., MAJORANA G., PAVONE P., TERRASI M.C. - 1978. Numeri cromosomici per la flora italiana:366-374.. Inform. Bot. Ital. , 10(1): 46-55.

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. II. Compositae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 299-314(1973).

CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).

CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.

CCDB · ipcn-api-dl — Brullo, S., G. MAJORANA, P. Pavone & M. C. TERRASI. 1978a. Numeri cromosomici per la flora Italiana: 366-374. Inform. Bot. Ital. 10: 46–55.

CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.

CCDB · book-ipcn67-71 — MURIN, A., & M.Y. SHEIKH. 1971. In IOPB chromosome reports XXXII. Taxon 20: 349-356.

CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dJ spermatophyta de Portugal. 47(Ser. 2l: 299-314. II Compositae, supl. I Bol. Soc. Brot. I

CCDB · eflora

CCDB · book-fedorov — Stebbins et al. 1953

CCDB · book-atlas-flowering-plants

CCDB · CromoCat 2015 — Brullo, S., Majorana, G., Pavone, P. & Terrasi, M. C. (1978c). Numeri cromosomici per la flora italiana: 366-374. Inf. Bot. Ital. 10: 46-55.

CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971a). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae. Bol. Soc. Brot. 45: 5-122.

CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, M. (1991). Kariologicno izsledvane na balgarski Sloznocvetni. IV. Tribus Carduae Cass. Fitologija 39: 3-22.

CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, V. (1986). Chromosome numbers of Bulgarian flowering plants. I, Fam. Asteraceae. Fitologija 31: 71-74.

CCDB · CromoCat 2015 — Murín, A. & M. Y. Sheikh. (1971). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXII]. Taxon 20(2/3): 353.

CCDB · CromoCat 2015 — Queirós, M. (1973b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. II. Compositae, supl. 1. Bol. Soc. Brot. 47: 299-314.

n 103×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 471-478. Mejas, J. A.Lagascalia14(2): 289-292(1986).

CCDB · ipcn-api-dl — Mejías, J. A. 1986. Números cromosómicos para la flora Española, 471--478. Lagascalia 14: 289–292.

CCDB · CromoCat 2015 — Mejías, J. A. (1986). Números cromosómicos para la flora española, 471-478. Lagascalia 14(2): 289-292.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 718 records

Wild obs. + sensor4 442

Museum / vouchered247

Cultivated / captive3

Other26

Origin

Native228

Introduced32

Range

Area of Occupancy AOO8 292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 518≤1 km 451≤10 km 1 134>10 km 26

2 129 georeferenced · 2 313 without coordinates

Open the mapobservation + sensor4 442

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 7≤1 km 51≤10 km 58>10 km 6

122 georeferenced · 125 without coordinates

Open the institutions mapphysical evidence247

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	23
BIO-UNIPIlocation not on record	22
Rishon Le Zion, IL	20
CICYTEXlocation not on record	20
BClocation not on record	20
College of the Atlantic, Museumlocation not on record	17
València, ES	12
Badajoz, ES	9
Sevilla, ES	9
ISAlocation not on record	8
Córdoba, ES	8
Brisbane, AU	7
Alicante, ES	4
Canberra, AU	4
South Kensington, GB	4
Institut und Museum fuer Geologie und Palaeontologielocation not on record	4
MAlocation not on record	4
Barcelona, ES	3
BDBClocation not on record	3
Jaén, ES	3
Paris, FR	3
MeiseBGlocation not on record	3
Xiamen, CN	2
Salamanca, ES	2
Granada, ES	2
Bourges, FR	2
PRClocation not on record	2
Museo Entomologico de Leonlocation not on record	2
LDlocation not on record	2
Berlin, DE	2
Saint Louis, US	1
Adelaide, AU	1
Armidale, AU	1
Canadian Department of Agriculturelocation not on record	1
JBSlocation not on record	1
Museo della Bonifica di San Donà di Piavelocation not on record	1
Bloomington, US	1
Brussel, BE	1
Dresden, DE	1
Adam Mickiewicz University in Poznańlocation not on record	1

40 institutions · 236 of 247 vouchered records shown · 11 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Scolymus maculatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Scolymus maculatus

At a glance

Sources12 archives

Size & morphology16

Life cycle & reproduction8

Diet & foraging1

Habitat & environment13

Physiology & chemistry6

Other traits3

Compound class profile2 classes

Documented compounds4 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 718 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions24 of 40 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type4 718 records