Scolopia zeyheri

(Nees) Szyszyl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Salicaceae/Scolopia

At a glance

Occurrence records489

Data sources6

Biological traits28

DNA specimens5

eDNA detections3

Sources6 archives

Databases and archives Scolopia zeyheri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility489 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Occurrence & distributionGBIF489 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Scolopia zeyheri là một loài thực vật có hoa trong họ Liễu. Loài này được (Nees) Szyszyl. miêu tả khoa học đầu tiên năm 1887.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height12 m

⚠ sources differ — GIFT: 12 m · TRY: 8 m

Plant height max13.1 m

Plant height min0.01 m

Seed mass17.6 mg

Seed mass max40.88 mg

Seed mass min5.79 mg

Life cycle & reproduction5

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 900 m

Elevation min5 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio35.2 g/g

Leaf c450 mg/g

Leaf n15.58 mg/g

Leaf p0.92 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)5.56 mm²/mg

Wood density680 mg/cm³

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scolopia zeyheri has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences4

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMT137498.1 ↗460 bpKenya · 2018

ACGT

AATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGC …

Scolopia zeyheri voucher NMK:EA 13535 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type489 records

Wild obs. + sensor448

Museum / vouchered40

Cultivated / captive1

Range

Area of Occupancy AOO1 408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 252≤1 km 62≤10 km 13>10 km 2

329 georeferenced · 119 without coordinates

Open the mapobservation + sensor448

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence40

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TAFORI-LSRClocation not on record	16
National Museums of Kenyalocation not on record	8
Kew, GB	4
MSB-3054location not on record	2
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	2
Zürich, CH	1
South African National Biodiversity Institutelocation not on record	1
Uppsala, SE	1

8 institutions · 35 of 40 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Scolopia zeyheri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 14.6–19.8

Seasonal swing summer↔winter9.30 °C

Max temp (day)23.2 °C 21.4–24.9

Min temp (night)11.4 °C 7.80–14.9

Precipitation31.5 mm/mo 12.0–51.1

Air humidity52.3 % 47.7–57.0

Moisture balance-76.2 mm/mo -82.4–-70.0

Vapour deficit929 Pa 866–991

Wind speed3.30 m/s 2.50–4.10

Cloud cover12.4 % 6.60–18.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)