Scolopia braunii

(Klotzsch) Sleumer · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Salicaceae/Scolopia

At a glance

Occurrence records2 279

Data sources9

Biological traits38

DNA specimens4

eDNA detections3

Sources9 archives

Databases and archives Scolopia braunii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 279 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources38 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF2 279 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Scolopia braunii is an Australian rainforest tree. Common names for this species include flintwood, mountain cherry, brown birch and scolopia. The habitat is Australian coastal rainforests of various types. The natural range of distribution of Scolopia braunii is between Jervis Bay (35° S) in the south to Cape York Peninsula at the northernmost part of Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology15

Fruit length12 mm

Fruit width12 mm

Leaf length65 mm

Leaf length max80 mm

Leaf length min40 mm

Leaf mass per area96.8 g/m2

Leaf size1 039 mm²

⚠ sources differ — TRY: 1 039 mm² · AusTraits: 1 739 mm²

Leaf width25 mm

Leaf width max40 mm

Leaf width min10 mm

Petiole length0.75 cm

Plant height25 m

⚠ sources differ — GIFT: 25 m · AusTraits: 30 m

Seed length4 mm

Seed mass3.3 mg

Seed width3 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timennnnnnnnyyyn

Life formtree

Life spanperennial

Pollination syndromebeetle

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate ovate rhomboidal

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)10.75 mm²/mg

Wood density663 mg/cm³

03Chemical composition2 compounds

Compounds documented for Scolopia braunii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Simple phenolic acids1

Cinnamic acids and derivatives1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
1-Cyclohexene-1-carboxylic acid,5-((3-(3,4-dihydroxyphenyl)-1-oxo-2-p ropenyl)oxy)-3,4-dihydroxy-,(3r-(3alpha,4alpha,5beta))-		present	LOTUS
Idesin		present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scolopia braunii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences2

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895904.1 ↗514 bpAustralia · 2012

ACGT

GAATTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCCGAGGA …

Scolopia braunii voucher 1076420336 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type2 279 records

Wild obs. + sensor1 455

Museum / vouchered534

Other290

Origin

Native41

Introduced1

Range

Area of Occupancy AOO5 656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 149≤1 km 109≤10 km 52>10 km 21

1 331 georeferenced · 124 without coordinates

Open the mapobservation + sensor1 455

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 75≤1 km 52≤10 km 220>10 km 74

421 georeferenced · 113 without coordinates

Open the institutions mapphysical evidence534

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	187
Smithfield, AU	118
Museo Entomologico de Leonlocation not on record	79
Mount Annan, AU	41
Canberra, AU	23
Armidale, AU	15
Palmerston, AU	10
Kew, GB	9
Wollongong, AU	6
John T. Waterhouse Herbariumlocation not on record	5
James Cook Townsvillelocation not on record	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
South Kensington, GB	3
Adelaide, AU	3
IPA/SPlocation not on record	2
Honolulu, US	2
CSIRO, Tropical Forest Research Centrelocation not on record	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
ASUlocation not on record	1
La Trobe Universitylocation not on record	1

20 institutions · 514 of 534 vouchered records shown · 19 without an institution code

09Environmental DNA3 detections

Where the DNA of Scolopia braunii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 15.8–20.9

Seasonal swing summer↔winter11.0 °C

Max temp (day)21.2 °C 20.3–27.0

Min temp (night)13.0 °C 11.7–14.6

Precipitation52.7 mm/mo 23.0–125

Air humidity63.9 % 47.5–64.1

Moisture balance-40.1 mm/mo -122–27.7

Vapour deficit685 Pa 648–1,436

Wind speed3.10 m/s 2.90–3.80

Cloud cover24.4 % 19.4–30.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Scolopia braunii

At a glance

Sources9 archives

Size & morphology15

Life cycle & reproduction9

Diet & foraging1

Habitat & environment9

Physiology & chemistry4

Compound class profile2 classes

Documented compounds2 total

At a glance

Record type2 279 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 279 records