Scolopendra mutilans

L.Koch, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Chilopoda/Scolopendromorpha/Scolopendridae/Scolopendra

At a glance

Occurrence records1 251

Data sources5

Biological traits0

DNA specimens123

eDNA detections123

Sources5 archives

Databases and archives Scolopendra mutilans's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 251 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI123 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics123 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 251 records

Environmental DNA1 datasets · 3 countries123 detections

DNA & barcodingBOLD123 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding123 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scolopendra mutilans has left across the world's sequence archives.

At a glance

DNA specimens123

BINs13

Marker genes3

eDNA detections123

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P632 bp consensus121 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 65 variable positions, in barcode order

5Tmostly conserved

29Amostly conserved

30Cmostly conserved

41Cmostly conserved

42Cmostly conserved

48Tmostly conserved

53Tmostly conserved

71Cmostly conserved

80Cvariable

86Tmostly conserved

104Tmostly conserved

107Gmostly conserved

110Tvariable

119Tmostly conserved

137Amostly conserved

143Amostly conserved

155Amostly conserved

167Tmostly conserved

173Amostly conserved

203Gvariable

212Tmostly conserved

233Tmostly conserved

236Amostly conserved

237Cvariable

240Tmostly conserved

245Amostly conserved

260Tmostly conserved

269Amostly conserved

279Amostly conserved

281Tmostly conserved

287Tmostly conserved

308Tmostly conserved

311Tmostly conserved

314Tmostly conserved

317Amostly conserved

320Tmostly conserved

321Tmostly conserved

350Gvariable

359Tmostly conserved

374Amostly conserved

375Tmostly conserved

395Cmostly conserved

407Gmostly conserved

416Tmostly conserved

428Tmostly conserved

456Tmostly conserved

500Amostly conserved

507Tmostly conserved

510Tmostly conserved

521Amostly conserved

522Cmostly conserved

527Cmostly conserved

542Amostly conserved

563Cmostly conserved

569Tmostly conserved

578Tmostly conserved

587Tvariable

590Tmostly conserved

596Tmostly conserved

602Tmostly conserved

611Tmostly conserved

614Tmostly conserved

615Tmostly conserved

617Gvariable

632Cmostly conserved

GAGCTTCAATAATCGGAACAGCATTAAGACTAATTATTCGCCTAGAATTAAGTCAACCAGGAAGTTTAATCGGAGATGACCAAACTTATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes31

BINs13

Most divergent pair10.6%

Asia

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 251 records

Wild obs. + sensor1 251

Range

Area of Occupancy AOO3 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 548≤1 km 224≤10 km 71>10 km 136

979 georeferenced · 272 without coordinates

Open the mapobservation + sensor1 251

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA123 detections

Where the DNA of Scolopendra mutilans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found123

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 123 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.7 °C 10.0–25.5

Seasonal swing summer↔winter27.3 °C

Max temp (day)24.0 °C 15.7–28.6

Min temp (night)16.0 °C 3.10–21.5

Precipitation49.8 mm/mo 13.8–296

Air humidity57.5 % 45.7–64.3

Moisture balance-27.0 mm/mo -132–154

Vapour deficit946 Pa 691–1,380

Wind speed3.00 m/s 2.60–4.70

Cloud cover33.8 % 24.1–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 103 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Scolopendra mutilans

At a glance

Sources5 archives

At a glance

Record type1 251 records

Range

Wildobservation + sensor

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 251 records