Scoliopus hallii

S.Watson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Scoliopus

At a glance

Occurrence records243

Data sources9

Biological traits10

DNA specimens6

eDNA detections6

Sources9 archives

Databases and archives Scoliopus hallii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF243 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Scoliopus hallii, the Oregon fetid adderstongue, is a plant species endemic to western Oregon.Biota of North America Project It is closely related to the California fetid adderstongue, Scoliopus bigelovii, but has yellow flowers with thin purple stripes rather than the purple flowers with yellow stripes as in S. bigeloviiWatson, Sereno. 1879. Proceedings of the American Academy of Arts and Sciences 14: 272

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scoliopus hallii has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes2

GenBank sequences8

eDNA detections6

The DNA barcodea real sequence read deposited for this species

rbcLAF206820.1 ↗1 181 bp

ACGT

AAGTGCTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACAAAAGATACTGATATCTTGGCAGC …

Scoliopus hallii ribulose 1,5-bisphosphate carboxylase (rbcL) gene, partial cds; chloroplast gene for chloroplast product

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Scoliopus hallii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 143×CCDB · book-ipcn66 · CCDB · eflora · CCDB · book-fedorov

CCDB · book-ipcn66 — Cave 1966b

CCDB · eflora

CCDB · book-fedorov — Cave 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.408 ↗

08Occurrence & distribution

Record type243 records

Wild obs. + sensor189

Museum / vouchered54

Range

Area of Occupancy AOO568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 79≤1 km 28≤10 km 9>10 km 41

157 georeferenced · 32 without coordinates

Open the mapobservation + sensor189

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 1≤1 km 33≤10 km 13>10 km 5

52 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence54

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	41
Chongqing Museumlocation not on record	5
WTUlocation not on record	2
Cheney, US	1
Wuzhou, CN	1
Tampa, US	1
AUAlocation not on record	1
Portland, US	1
DOI/NPS, Greenbelt Parklocation not on record	1

9 institutions · 54 of 54 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Scoliopus hallii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)