Sclerotium delphinii

Welch, 1924 · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Typhulaceae/Sclerotium

At a glance

Occurrence records78

Data sources8

Biological traits0

DNA specimens8

eDNA detections8

Sources8 archives

Databases and archives Sclerotium delphinii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility78 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF78 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceGoaT · NCBI≈72 Mbp

01Narrative

Sclerotium delphinii is a plant pathogen infecting mangoes.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sclerotium delphinii has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes1

GenBank sequences10

eDNA detections8

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPX418270.1 ↗265 bpEgypt · 2025

ACGT

GCTTTGGCATCATATATGCGTAGGAGTTGTGCTGGTAATGAATATTGCATGTGCACACTCTGGAGCTATATAATATATACAGCGCTGTGA …

Agroathelia delphinii isolate Sc. rol internal transcribed spacer region, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Sclerotium delphinii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈72 081 797 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Sclerotium delphinii0.07 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type78 records

Museum / vouchered78

Range

Area of Occupancy AOO192 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤1 km 5≤10 km 48>10 km 8

61 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence78

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Catholic University of Pekinglocation not on record	47
Bernard Price Institute for Palaeontological Researchlocation not on record	22
Pullman, US	1

3 institutions · 70 of 78 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Sclerotium delphinii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.90 °C 7.40–12.5

Seasonal swing summer↔winter26.2 °C

Max temp (day)14.0 °C 9.60–18.4

Min temp (night)5.60 °C 3.00–8.20

Precipitation212 mm/mo 79.6–344

Air humidity61.1 % 57.3–64.9

Moisture balance112 mm/mo -38.4–263

Vapour deficit580 Pa 428–733

Wind speed4.40 m/s 2.90–5.80

Cloud cover40.6 % 36.7–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)