Scleria mackaviensis

Boeckeler · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Scleria

At a glance

Occurrence records2 817

Data sources9

Biological traits27

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Scleria mackaviensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 817 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF2 817 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Scleria mackaviensis is a plant in the family Cyperaceae. It grows as a tufted sedge.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology5

Leaf length max1.5 mm

Leaf length min0.8 mm

Leaf width1.5 mm

Leaf width max1.5 mm

Leaf width min0.8 mm

Life cycle & reproduction9

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyynnnnnnyyyy

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Pollination syndromeabiotic

Resprouting capacityresprouts

Sex typedioecious+hermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Leaf compoundnesssimple

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition6 compounds

Compounds documented for Scleria mackaviensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Anthocyanidins3

Flavonols2

Aurones1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
Aureusidin	present	LOTUS
Cyanidin	present	LOTUS
Kaempferol	present	LOTUS
Pelargonidin	present	LOTUS
Quercetin	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scleria mackaviensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLN886847.1 ↗692 bpAustralia

ACGT

CGTAGGTGAAGCTGCGGAAGGATCATTGTCGCTGACTCGGGAAAATATGACCGGAGCACGTGTGATAGAGCAATCGCTGGGGCGGCGGTG …

Scleria mackaviensis genomic DNA sequence contains ITS1, 5.8S rRNA gene, ITS2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type2 817 records

Wild obs. + sensor1 958

Museum / vouchered430

Cultivated / captive1

Other428

Origin

Native83

Range

Area of Occupancy AOO7 268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 1 909≤1 km 19≤10 km 12>10 km 2

1 942 georeferenced · 16 without coordinates

Open the mapobservation + sensor1 958

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 169≤1 km 23≤10 km 155>10 km 46

393 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence430

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	232
Mount Annan, AU	84
NSW Dept of Planning, Industry and Environmentlocation not on record	22
Armidale, AU	18
Canberra, AU	17
Smithfield, AU	13
Palmerston, AU	10
Museo Entomologico de Leonlocation not on record	9
Kew, GB	6
John T. Waterhouse Herbariumlocation not on record	5
NSW Office of Environment and Heritagelocation not on record	3
James Cook Townsvillelocation not on record	3
Wollongong, AU	2
Adelaide, AU	2
Honolulu, US	2
Beijing, CN	1
Auckland, NZ	1

17 institutions · 430 of 430 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Scleria mackaviensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Scleria mackaviensis

At a glance

Sources9 archives

Size & morphology5

Life cycle & reproduction9

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

Compound class profile3 classes

Documented compounds6 total

At a glance

Record type2 817 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 817 records