Scilla hyacinthoides

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Scilla

At a glance

Occurrence records1 905

Data sources7

Biological traits16

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Scilla hyacinthoides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 905 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources16 traits

Occurrence & distributionGBIF1 905 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

Scilla hyacinthoides is een bolgewas uit de aspergefamilie (Asparagaceae). De 80 cm hoge plant komt van nature voor in het Midden-Oosten, waar de soort groeit op rotsige, droge plaatsen, langs wegen. De plant bloeit van maart tot mei met 1–2 cm brede, paars-blauwe bloemen. De plant heeft aan de basis acht tot twaalf langwerpige bladeren, die 1,5–3 cm breed zijn.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology4

Leaf length350 mm

Leaf width25 mm

Plant height0.45 m

Seed mass11.12 mg

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scilla hyacinthoides has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences7

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLOM972773.1 ↗513 bp

ACGT

TTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGATACTGATATTTTGGCAGCATTCCGAGTAA …

Scilla hyacinthoides voucher HY3770 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Scilla hyacinthoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidypolyploid inferred

Chromosome records20–202n range20median20mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 209×CCDB · ita-fl · CCDB · iber-fl · CCDB · fl-europaea +4

CCDB · ita-fl — SCRUGLI A., COGONI A. - 1991 (1990). Structural heterozygosity in Scilla hyacinthoides L. and Scilla amoena L. (Liliaceae). Kariological analysis.. Giorn. Bot. Ital. , 124(5): 623-629.

CCDB · iber-fl — Contribution la connaissance cytotaxonomique des spermatophyta du Portugal. VIII. Liliaceae Barros Neves, J.Bol. Soc. Brot. ser. 247: 157-212(1973).

CCDB · fl-europaea — Barros Neves, 1973

CCDB · book-ipcn73-74 — BARROS NEVES, J. 1973. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. VIII. Liliaceae. Bol. Soc. Brot. 47(Ser. 2}: 157 212.

CCDB · book-ipcn73-74 — NODA, S. 1973. On Scilla alliances. Shin-kaki 78: 10-17.

CCDB · book-ipcn73-74 — CARLSSON, M., E. ELLMER, A. NOLIN, K. NYBERG, & C. WIKING. 1974. Chromosome morphology in Scilla hyacinthoides L. Bot. Notiser 127: 87- 88.

CCDB · book-atlas-flowering-plants — Sato 1935a

CCDB · Cave1959 — Gim.-Mart. 1959d; Battagli a 1959

CCDB · CromoCat 2015 — Barros Neves, J. (1973). Contribution à la connaissance cytotaxonomique des Spermatophyta du Portugal. VIII. Liliaceae. Bol. Soc. Brot. 47: 157-212.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.977 ↗

08Occurrence & distribution

Record type1 905 records

Wild obs. + sensor1 832

Museum / vouchered64

Cultivated / captive6

Other3

Origin

Native1

Introduced1

Range

Area of Occupancy AOO2 180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 200≤1 km 66≤10 km 103>10 km 6

375 georeferenced · 1 457 without coordinates

Open the mapobservation + sensor1 832

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 2≤1 km 6≤10 km 9>10 km 2

19 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence64

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 6

6 georeferenced

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Rishon Le Zion, IL	18
Adelaide, AU	9
BDBClocation not on record	5
MAlocation not on record	3
Bratislava, SK	3
Paris, FR	2
Barcelona, ES	2
Kew, GB	2
BClocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
LDlocation not on record	2
ISAlocation not on record	1
Vancouver, CA	1
Xiamen, CN	1
Dresden, DE	1
Provincia di Livornolocation not on record	1
Wellington, NZ	1
Berlin, DE	1
CICYTEXlocation not on record	1
Canberra, AU	1
València, ES	1
Fort Worth, US	1
Badajoz, ES	1

23 institutions · 62 of 64 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Scilla hyacinthoides

At a glance

Sources7 archives

Size & morphology4

Life cycle & reproduction3

Diet & foraging1

Habitat & environment7

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 905 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 23 geolocated

Cultivated / Captivenot free-living

Record type1 905 records