Scilla bifolia
speciesAt a glance
Occurrence records43 587
Data sources12
Biological traits41
DNA specimens5
eDNA detections2
Sources12 archives
Databases and archives Scilla bifolia's data was compiled from.
WikipediaWikimedia Foundation10 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility43 587 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics5 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Occurrence & distributionGBIF43 587 records
Environmental DNA1 datasets · 2 countries2 detections
DNA & barcodingBOLD · NCBI5 specimens
Genome at a glanceCCDB · GoaT6.7 Gbp
01Narrative
Der Speta-Blaustern (Scilla spetana) ist eine Pflanzenart aus der Gattung der Blausterne (Scilla) in der Familie der Spargelgewächse (Asparagaceae).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass53.45 mg
Leaf size2 377 mm²
Plant height0.15 m
⚠ sources differ — GIFT: 0.15 m · LEDA: 0.15 m · TRY: 0.2 m
Plant height generative0.15 m
Plant height max0.45 m
Plant height min0.05 m
Seed length2.25 mm
Seed mass8.89 mg
⚠ sources differ — TRY: 8.89 mg · LEDA: 9.55 mg · GIFT: 9.55 mg
Seed mass max9.55 mg
Seed mass min9.55 mg
Life cycle & reproduction14
Deciduousnessvernal
Dehiscencedehiscent
Dispersal typeblastochor
⚠ sources differ — LEDA: blastochor · GIFT: zoochorous
Flowering endApr
Flowering startMar
Life formbulbous geophyte
Life spanperennial
Lifespan years10 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Reproduction asexualabsent
Seed number16
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTforest edges, meadows, mountains, shrubberies
Woodinessnon-woody
Physiology & chemistry6
Leaf C:N ratio10.13 g/g
Leaf c454 mg/g
Leaf dry-matter content (LDMC)95.89 mg/g
⚠ sources differ — TRY: 95.89 mg/g · LEDA: 78.61 mg/g
Leaf n44.84 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)27.12 mm²/mg
⚠ sources differ — TRY: 27.12 mm²/mg · LEDA: 41.45 mm²/mg · GIFT: 41.45 mm²/mg
Other traits1
Diaspore typeseed
05DNA & barcoding5 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scilla bifolia has left across the world's sequence archives.
At a glance
DNA specimens5
Marker genes2
GenBank sequences10
eDNA detections2
Countries3
The DNA barcodea real sequence read deposited for this species
TTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGATACTGATATTTTGGCAGCATTCCGAGTAA …
Scilla bifolia voucher HY3771 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK6★rbcL4
plant barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Scilla bifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size6 650 400 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Scilla bifolia6.65 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy2× diploid · measured
Chromosome records16–542n range36median36mode117records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3655×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +4
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GREILHUBER J., SPETA F. - 1985. Geographical variation of genome size at low taxonomic levels in the Scilla bifolia alliance (Hyacinthaceae).. Flora , 176: 431-438.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · slov-fl — Letz R., Uhríková A. & Májovský J., 1999: Chromosome numbers of several interesting taxa of the flora of Slovakia. - Biologia (Bratislava) 54/1: 43-49.
CCDB · slov-fl — Kochjarová J., 2000: Karyologická analýza populácií Scilla bifolia agg. z Drienčanského krasu, pp. 151-153. - In: Kliment J. (ed.), Príroda Drienčanského krasu. Štátna ochrana prírody SR Banská Bystrica.
CCDB · slov-fl — Kalhousová Y., 2007: [New records in Scilla], pp. 526, 530. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · slov-fl — Kochjarová J., 2005b: Scilla bifolia group in the Western Carpatians and adjacent part of the Pannonian lowland: annotated chromosome counts. - Preslia 773: 317-326.
CCDB · fl-europaea — Susnik & Lovka,
CCDB · ipcn-api-dl — Sopova, M. & Z. Sekovski. 1982. Chromosome atlas of some Macedonian angiosperms. III. God. Zborn. Biol. Fak. Univ. Kiril Metod. 35: 145–161.
CCDB · ipcn-api-dl — Lovka, M. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 21–23.
CCDB · ipcn-api-dl — Kereszty, Z., L. Szilágyi & A. Borhidi. 1986. Biosystematic studies of the Scilla bifolia complex in Hungary. Symb. Bot. Upsal. 27: 107–112.
CCDB · ipcn-api-dl — Keresti, Z. & A. I. Pogosian. 1987. Comparative analysis of Scilla bifolia L. agg. (Liliaceae) populations in Hungary. Fl. Rastitel'nost' Rastitel'nye Resursy Armyansk. S.S.R. 10: 97–105.
CCDB · ipcn-api-dl — Kereszty, Z. 1987. Chromosome morphology and DNA content in the systematics of the Scilla bifolia aggregate. Acta Bot. Hung. 33: 305–316.
CCDB · ipcn-api-dl — Greilhuber, J. & F. Speta. 1977. Giemsa karyotypes and their evolutionary significance in Scilla bifolia, S. drunensis and S. vindobonensis (Liliaceae). Pl. Syst. Evol. 127: 171–190.
CCDB · ipcn-api-dl — Kochjarova, J. 2005. Scilla bifolia group in the western Carpathians and adjacent part of the Pannonian lowland: annotated chromosome counts. Preslia 77(3): 317–326.
CCDB · ipcn-api-dl — Speta, F. 1976. Cytotaxonomischer beitrag zur kenntis der Scilla nivalis - gruppe. Linzer Biol. Beitr. 8: 293–322.
CCDB · ipcn-api-dl — Letz, R., A. Uhríková & J. Májovský. 1999. Chromosome numbers of several interesting taxa of the flora of Slovakia. Biologia (Bratislava) 54: 43–49.
CCDB · ipcn-api-dl — Speta, F. 1991. Zwei neue Scilla-Arten (Hyacinthaceae) aus der S-Türkei. Willdenowia 21: 157–166.
CCDB · book-ipcn72 — MOSKOVA, R.D . & G.N. GEORGIEV. 1972. Karyological data on Scilla bifolia L. Dokl. Bulg. Akad. Nauk 25: 111-112.
CCDB · kew — Greilhuber J, Strehl S. 1985. Deviating basic genome size in a hexaploid population of Scilla bifolia agg. in the valley Kreuttal (Weinviertel; Lower Austria). Stapfia 14: 127-134.
CCDB · kew — Greilhuber J. 1979. Evolutionary changes of DNA and heterochromatin amounts in the Scilla bifolia group (Liliaceae). Plant Systematics and Evolution Suppl. 2: 263-280.
2n 1844×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +8
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GREILHUBER J., SPETA F. - 1985. Geographical variation of genome size at low taxonomic levels in the Scilla bifolia alliance (Hyacinthaceae).. Flora , 176: 431-438.
CCDB · ita-fl — CAPARELLI K. F., AQUARO G., PERUZZI L. - 2007. Numeri Cromosomici per la Flora Italiana 1460-1463. Inform. Bot. Ital. , 39(1): 233-235.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Murín A. & Májovský J., 1979: Karyological Study of slovakian flora I. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 27: 127-133.
CCDB · fl-europaea — Susnik Lovka,
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · ipcn-api-dl — Sopova, M. & Z. Sekovski. 1981. Chromosome atlas of some Macedonian angiosperms. Ann. Fac. Biol. Univ. Skopje. 34: 65–76.
CCDB · ipcn-api-dl — Speta, F. 1983. Botanik. In: H. Kohl (editor), 150 Jahre Oberosterrichisches. Pp. 93–106.
CCDB · ipcn-api-dl — Zakharjeva, O. I. 1990. <In> A. Takhtajan (editor), Numeri Chromosomatum Magnoliophytorum Florae URSS, Aceraceae--Menyanthaceae. Nauka, Leninopoli
CCDB · ipcn-api-dl — Murin, A. & J. Majovsky. 1979. Karyological study of Slovakian flora I. Acta Fac. Rerum Nat. Univ. Comeninae, Bot. 27: 127–133.
CCDB · ipcn-api-dl — Greilhuber, J. & F. Speta. 1977. Giemsa karyotypes and their evolutionary significance in Scilla bifolia, S. drunensis and S. vindobonensis (Liliaceae). Pl. Syst. Evol. 127: 171–190.
CCDB · ipcn-api-dl — Greilhuber, J., B. Deumling & F. Speta. 1981. Evolutionary aspects of chromosome banding, heterochromatin, satellite DNA and genome size in Scilla (Liliaceae). Ber. Deutsch. Bot. Ges. 94: 249–266.
CCDB · ipcn-api-dl — Papanicolaou, K. 1984. Chromosome Number Reports LXXXII. Taxon 33: 126–134.
CCDB · ipcn-api-dl — Speta, F. 1976. Cytotaxonomischer beitrag zur kenntis der Scilla nivalis - gruppe. Linzer Biol. Beitr. 8: 293–322.
CCDB · ipcn-api-dl — Speta, F. 1991. Zwei neue Scilla-Arten (Hyacinthaceae) aus der S-Türkei. Willdenowia 21: 157–166.
CCDB · book-ipcn72 — SPETA, F. 1972. Entwicklungsgeschichte und Karyologie von Elaiosomen an Samen und Fruchten. Naturhandlicher Jahrb. Stadt Linz 1972 pp. 9-65.
CCDB · book-ipcn75-78 — Skalinska et al. 1976
CCDB · book-fedorov — Sato D. 1935a, 1942
CCDB · book-fedorov — P6lya 1950
CCDB · book-fedorov — Garajova 1959 (I. Slov.
CCDB · book-atlas-flowering-plants
CCDB · kew — Greilhuber J. 1979. Evolutionary changes of DNA and heterochromatin amounts in the Scilla bifolia group (Liliaceae). Plant Systematics and Evolution Suppl. 2: 263-280.
CCDB · kew — Greilhuber J, Speta F. 1985. Geographical variation of genome size at low taxonomic levels in the Scilla bifolia alliance (Hyacinthaceae). Flora 176: 431-438.
CCDB · kew — Nagl W, Frisch B, Frolich E. 1979. Extra DNA during floral induction. Plant Systematics and Evolution Suppl. 2: 111-118.
CCDB · kew — Greilhuber J, Deumling B, Speta F. 1981. Evolutionary aspects of chromosome banding, heterochromatin, satellite DNA, and genome size in Scilla (Liliaceae). Berichte Der Deutschen Botanischen Gesellschaft 94: 249-266.
CCDB · kew — Greilhuber J. (pers. comm. 1982).
2n 5411×CCDB · slov-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +1
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · slov-fl — Kalhousová Y., 2007: [New records in Scilla], pp. 526, 530. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · slov-fl — Kochjarová J., 2005b: Scilla bifolia group in the Western Carpatians and adjacent part of the Pannonian lowland: annotated chromosome counts. - Preslia 773: 317-326.
CCDB · fl-europaea — Speta, 1976
CCDB · ipcn-api-dl — Speta, F. 1976. Cytotaxonomischer beitrag zur kenntis der Scilla nivalis - gruppe. Linzer Biol. Beitr. 8: 293–322.
CCDB · ipcn-api-dl — Kereszty, Z., L. Szilágyi & A. Borhidi. 1986. Biosystematic studies of the Scilla bifolia complex in Hungary. Symb. Bot. Upsal. 27: 107–112.
CCDB · ipcn-api-dl — Kereszty, Z. 1987. Chromosome morphology and DNA content in the systematics of the Scilla bifolia aggregate. Acta Bot. Hung. 33: 305–316.
CCDB · ipcn-api-dl — Kochjarova, J. 2005. Scilla bifolia group in the western Carpathians and adjacent part of the Pannonian lowland: annotated chromosome counts. Preslia 77(3): 317–326.
CCDB · kew — Greilhuber J. 1979. Evolutionary changes of DNA and heterochromatin amounts in the Scilla bifolia group (Liliaceae). Plant Systematics and Evolution Suppl. 2: 263-280.
2n 203×CCDB · book-fedorov
CCDB · book-fedorov — Miiller C. '1912
CCDB · book-fedorov — Heitz 1926
CCDB · book-fedorov — Delay 1947
2n 162×CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78
CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.
CCDB · book-ipcn75-78 — Sharma 1970
2n 262×CCDB · book-fedorov · CCDB · Cave1959
CCDB · book-fedorov — Gimenez-Martin 1959d
CCDB · Cave1959 — Girn.-Mart. 1959d
2n 271×CCDB · ita-fl
CCDB · ita-fl — GREILHUBER J., SPETA F. - 1985. Geographical variation of genome size at low taxonomic levels in the Scilla bifolia alliance (Hyacinthaceae).. Flora , 176: 431-438.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.954 ↗
07Deep time~0.74 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0.74 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type43 587 records
Wild obs. + sensor41 463
Museum / vouchered1 890
Cultivated / captive8
Other226
Origin
Native5
Introduced120
Range
Area of Occupancy AOO55 296 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy35% within 1 km
≤100 m 9 081≤1 km 2 572≤10 km 20 980>10 km 359
32 992 georeferenced · 8 471 without coordinates
Open the mapobservation + sensor41 463
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy45% within 1 km
≤100 m 138≤1 km 221≤10 km 428>10 km 9
796 georeferenced · 1 094 without coordinates
Open the institutions mapphysical evidence1 890
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤100 m 1
1 georeferenced · 7 without coordinates
Open the mapnot free-living8
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions32 of 75 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 267 |
| Uniwersytet Wrocławskilocation not on record | 247 |
| BFLlocation not on record | 136 |
| MeiseBGlocation not on record | 92 |
| LDlocation not on record | 80 |
| Moscow State Universitylocation not on record | 63 |
| Salzburg, AT | 59 |
| Zürich, CH | 57 |
| SLU Artdatabankenlocation not on record | 49 |
| Bern, CH | 49 |
| Provincia di Livornolocation not on record | 44 |
| Berlin, DE | 39 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 30 |
| Adam Mickiewicz University in Poznańlocation not on record | 29 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 28 |
| Oskarshamn, SE | 28 |
| LfUlocation not on record | 27 |
| Karlsruhe, DE | 25 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 19 |
| Mlocation not on record | 19 |
| DBF-NHMDlocation not on record | 19 |
| Paris, FR | 14 |
| BRNUlocation not on record | 14 |
| Porrentruy, CH | 13 |
| No collectionlocation not on record | 13 |
| Dresden, DE | 13 |
| Frankfurt am Main | 12 |
| Wlocation not on record | 11 |
| Zürich, CH | 10 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| Bourges, FR | 7 |
| Wellington, NZ | 6 |
| Görlitz, DE | 6 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 5 |
| Fulda, DE | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| Auckland, NZ | 5 |
| GJOlocation not on record | 4 |
| GZUlocation not on record | 4 |
| CJBGlocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Muséum Henri Lecoqlocation not on record | 3 |
| FLADlocation not on record | 3 |
| Durham, US | 3 |
| Tilburg, NL | 3 |
| Boumlocation not on record | 2 |
| Copenhagen, DK | 2 |
| SZUlocation not on record | 2 |
| Ivano-Frankove, UA | 2 |
| BClocation not on record | 2 |
| BGBMlocation not on record | 2 |
| New Haven, US | 2 |
| MAlocation not on record | 2 |
| Barcelona, ES | 2 |
| Dekalb, US | 2 |
| Salvador, BR | 1 |
| H-Meierottlocation not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| Clocation not on record | 1 |
| Millersville, US | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Kew, GB | 1 |
| CJBNlocation not on record | 1 |
| Firenze, IT | 1 |
| Vancouver, CA | 1 |
| University of Alberta Museumslocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Columbia, US | 1 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 1 |
| Bergen, NO | 1 |
| PRClocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Salamanca, ES | 1 |
| Olocation not on record | 1 |
| South Kensington, GB | 1 |
75 institutions · 1 620 of 1 890 vouchered records shown · 269 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA2 detections
Where the DNA of Scilla bifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found2
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 2 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median7.90 °C 5.90–9.90
Seasonal swing summer↔winter20.5 °C
Max temp (day)12.4 °C 9.80–15.1
Min temp (night)2.30 °C 1.50–3.00
Precipitation54.3 mm/mo 44.7–63.9
Air humidity58.3 % 55.1–61.5
Moisture balance-17.9 mm/mo -43.1–7.30
Vapour deficit525 Pa 379–672
Wind speed3.20 m/s 2.80–3.70
Cloud cover39.9 % 35.4–44.5
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.