Scilla amoena

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Scilla

At a glance

Occurrence records553

Data sources8

Biological traits24

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Scilla amoena's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility553 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF553 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 12

01Narrative

Scilla amoena là một loài thực vật có hoa trong họ Măng tây. Loài này được L. miêu tả khoa học đầu tiên năm 1753.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology6

Plant height0.225 m

⚠ sources differ — GIFT: 0.225 m · LEDA: 0.225 m · TRY: 0.237 m

Plant height generative0.225 m

Plant height max0.3 m

Plant height min0.2 m

Seed length1.69 mm

Seed mass3.35 mg

Life cycle & reproduction9

Deciduousnessalways spring green

Dispersal typeanimal

Flowering startMay

Life formbulbous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Diaspore typeseed

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Scilla amoena has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLPX857721.1 ↗154 274 bp

ACGT

AGCTATCCCCAATATTTTACGAAAACAAGCTATTGGGGATAGCTCCTTGAATTCACCGAGTCTTAATACAATACATTAAGACAGAAGTCT …

Scilla amoena isolate S.amoB(R) chloroplast sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Scilla amoena carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–122n range12median12mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1210×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +4

CCDB · ita-fl — SCRUGLI A., COGONI A. - 1991 (1990). Structural heterozygosity in Scilla hyacinthoides L. and Scilla amoena L. (Liliaceae). Kariological analysis.. Giorn. Bot. Ital. , 124(5): 623-629.

CCDB · ipcn-api-dl — Deumling, B. & J. Greilhuber. 1982. Characterization of heterochromatin in different species of the Scilla siberica group (Liliaceae) by in situ hybridization of satellite DNAs and fluorochrome banding. Chromosoma 84: 535–555.

CCDB · ipcn-api-dl — Breger, R. & J. Greilhuber. 1993. C-Bands and chiasma distribution in Scilla amoena, S. ingridae, and S. mischtchenkoana (Hyacinthaceae). Pl. Syst. Evol. 184: 125–137.

CCDB · ipcn-api-dl — Greilhuber, J., B. Deumling & F. Speta. 1981. Evolutionary aspects of chromosome banding, heterochromatin, satellite DNA and genome size in Scilla (Liliaceae). Ber. Deutsch. Bot. Ges. 94: 249–266.

CCDB · ipcn-api-dl — Greilhuber, J. & F. Speta. 1978. Quantitative analyses of C-banded karyotypes and systematics in the cultivated species of the Scilla siberica group. Pl. Syst. Evol. 129: 63–109.

CCDB · book-ipcn72 — SPETA, F. 1972. Entwicklungsgeschichte und Karyologie von Elaiosomen an Samen und Fruchten. Naturhandlicher Jahrb. Stadt Linz 1972 pp. 9-65.

CCDB · book-ipcn67-71 — Q1Q SPETA, F. 1971. Beitrag zur Systematik von Scilla L. subgen. Scilla (inklusive Chionodoxa Boiss.). oesterr.~z. 119: 6-18.

CCDB · book-fedorov — Gimenez-Martin 1959a, d

CCDB · kew — Greilhuber J, Deumling B, Speta F. 1981. Evolutionary aspects of chromosome banding, heterochromatin, satellite DNA, and genome size in Scilla (Liliaceae). Berichte Der Deutschen Botanischen Gesellschaft 94: 249-266.

CCDB · Cave1959 — Gim.-Mart. 1959a,d.

n 61×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Breger, R. & J. Greilhuber. 1993. C-Bands and chiasma distribution in Scilla amoena, S. ingridae, and S. mischtchenkoana (Hyacinthaceae). Pl. Syst. Evol. 184: 125–137.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type553 records

Wild obs. + sensor458

Museum / vouchered95

Range

Area of Occupancy AOO1 268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 275≤1 km 21≤10 km 132>10 km 2

430 georeferenced · 28 without coordinates

Open the mapobservation + sensor458

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 17≤1 km 2≤10 km 19>10 km 6

44 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	18
BFLlocation not on record	15
Bern, CH	13
LDlocation not on record	11
Berlin, DE	8
Uppsala, SE	7
Mlocation not on record	5
Dresden, DE	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
Porrentruy, CH	1
Wellington, NZ	1
Fribourg, CH	1
Görlitz, DE	1
Auckland, NZ	1

16 institutions · 92 of 95 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)