Schwenckia americana
speciesAt a glance
Occurrence records2 397
Data sources10
Biological traits18
DNA specimens17
eDNA detections7
Sources10 archives
Databases and archives Schwenckia americana's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility2 397 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics17 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources18 traits
Occurrence & distributionGBIF2 397 records
Environmental DNA1 datasets · 1 countries7 detections
DNA & barcodingBOLD · NCBI17 specimens
Genome at a glanceCCDB2n = 20
01Narrative
들담배(스페인어: tabaco cimarrón, 학명: Schwenckia americana 스크웽키아 아메리카나[*])는 가지과의 한해살이 또는 여러해살이 초본식물이다. 원산지는 아메리카이며, 아프리카의 많은 지역에도 귀화해 자생한다.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology4
Plant height0.8 m
Plant height max0.914 m
Plant height min0.305 m
Seed mass0.102 mg
Life cycle & reproduction3
Life formannual or perennial
Life spanperennial
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 000 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTÁrea Antrópica
Woodinessnon-woody
Physiology & chemistry1
Nitrogen fixingnon_nitrogen_fixer
05DNA & barcoding17 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Schwenckia americana has left across the world's sequence archives.
At a glance
DNA specimens17
Marker genes4
GenBank sequences10
eDNA detections7
Countries1
The DNA barcodea real sequence read deposited for this species
AGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTCAGTACCAAACCAAGGATACTGATATATTGGCAGCA …
Schwenkia americana voucher BioBot11484 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL6★rbcLa★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Schwenckia americana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidypolyploid inferred
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 201×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Chiarini, F. E. 2003. Los cromosomas somáticos de Schwenckia americana (Solanaceae). Bol. Soc. Argent. Bot. 38(3–4): 325–327.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=0.916 ↗
08Occurrence & distribution
Record type2 397 records
Wild obs. + sensor356
Museum / vouchered2 021
Other20
Origin
Native361
Range
Area of Occupancy AOO5 136 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy31% within 1 km
≤100 m 14≤1 km 1≤10 km 29>10 km 4
48 georeferenced · 308 without coordinates
Open the mapobservation + sensor356
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy46% within 1 km
≤100 m 35≤1 km 2≤10 km 30>10 km 13
80 georeferenced · 1 941 without coordinates
Open the institutions mapphysical evidence2 021
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions53 of 156 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 251 |
| Bronx, US | 144 |
| Laboratorio de Ictiologialocation not on record | 78 |
| UFMGlocation not on record | 70 |
| Paris, FR | 59 |
| Kew, GB | 58 |
| MeiseBGlocation not on record | 49 |
| Paleontological Collectionlocation not on record | 42 |
| Yaoundé, CM | 41 |
| LBVlocation not on record | 38 |
| WAGlocation not on record | 37 |
| UNIVASFlocation not on record | 33 |
| National Biodiversity Institute, Costa Ricalocation not on record | 32 |
| JBRJlocation not on record | 31 |
| UFBAlocation not on record | 30 |
| UEMlocation not on record | 28 |
| Feira de Santana, BR | 27 |
| Herbier National du Gabonlocation not on record | 27 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 27 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 26 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 26 |
| Chicago, US | 24 |
| HNBlocation not on record | 23 |
| LSF/FSA/UAClocation not on record | 22 |
| Departamento de Sistematica e Ecologialocation not on record | 19 |
| University of Stellenboschlocation not on record | 17 |
| Chaguaramas, TT | 17 |
| Cruz das Almas, BR | 16 |
| UFPElocation not on record | 16 |
| Mexico City, MX | 15 |
| UnBlocation not on record | 15 |
| Antiguo Cuscatlán, SV | 15 |
| Plocation not on record | 14 |
| Durango, MX | 14 |
| Instituto do Meio Ambientelocation not on record | 14 |
| Mérida, MX | 14 |
| Brasília, BR | 13 |
| Frankfurt am Main | 13 |
| CEPLAClocation not on record | 13 |
| Cenargenlocation not on record | 12 |
| Brasília, BR | 12 |
| León, NI | 11 |
| Santarém, BR | 10 |
| UNICAMPlocation not on record | 10 |
| USP-IBlocation not on record | 10 |
| FPMZBlocation not on record | 10 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 9 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 8 |
| MAlocation not on record | 8 |
| San Isidro, AR | 8 |
| Universidad Nacional de Asunciónlocation not on record | 8 |
| Salvador, BR | 8 |
| UFOPlocation not on record | 8 |
| Pretoria, ZA | 8 |
| LSFlocation not on record | 8 |
| Université du Lomélocation not on record | 7 |
| Berlin, DE | 7 |
| Universidade Federal do Maranhãolocation not on record | 6 |
| UFMSlocation not on record | 6 |
| BRLUlocation not on record | 6 |
| CNF-UFHBlocation not on record | 6 |
| Area de Conservacion Guanacastelocation not on record | 6 |
| Museu Paraense Emílio Goeldilocation not on record | 6 |
| UFERSAlocation not on record | 5 |
| Uberlândia, BR | 5 |
| Elocation not on record | 5 |
| San Francisco de Campeche, MX | 5 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 5 |
| Santa Cruz de la Sierra, BO | 5 |
| Edinburgh, GB | 5 |
| Clocation not on record | 5 |
| UFRPElocation not on record | 5 |
| Bogotá, D.C., CO | 5 |
| CPATSAlocation not on record | 4 |
| Corrientes, AR | 4 |
| Masindi, UG | 4 |
| Universidade Federal de Santa Catarinalocation not on record | 4 |
| Stockholm, SE | 4 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 4 |
| Tapachula, MX | 4 |
| UFSJlocation not on record | 4 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 4 |
| UFSClocation not on record | 4 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 4 |
| Universidad Nacional de Colombia (UNAL)location not on record | 4 |
| Jataí / Setor Industrial, BR | 3 |
| HACAMlocation not on record | 3 |
| Moscow State Universitylocation not on record | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| CJBGlocation not on record | 3 |
| LISClocation not on record | 3 |
| Xiamen, CN | 3 |
| Córdoba, AR | 3 |
| UNESP-RClocation not on record | 2 |
| Aarhus, DK | 2 |
| URCAlocation not on record | 2 |
| Universidade Federal do Espírito Santolocation not on record | 2 |
| Austin, US | 2 |
| UNESP-IBILCElocation not on record | 2 |
| Austin, US | 2 |
| Universidade Federal de Sergipe (UFS)location not on record | 2 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 2 |
| Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record | 2 |
| Universidad Nacional Federico Villarreallocation not on record | 2 |
| Botanic Gardenlocation not on record | 2 |
| CMULlocation not on record | 2 |
| Altos de Pipe, VE | 2 |
| Ivano-Frankivsk, UA | 2 |
| Forestry Research Institute of Nigerialocation not on record | 2 |
| Chongqing Museumlocation not on record | 2 |
| Universidade Paulistalocation not on record | 2 |
| Pullman, US | 2 |
| University of Oxfordlocation not on record | 2 |
| Fortaleza, BR | 2 |
| Llocation not on record | 2 |
| Uppsala, SE | 2 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 2 |
| LDlocation not on record | 2 |
| Porto Alegre, BR | 2 |
| University of Santo Tomas Museumlocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Montpellier, FR | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Mlocation not on record | 1 |
| UESBlocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| San José, CR | 1 |
| Santa Teresa, BR | 1 |
| Université National du Béninlocation not on record | 1 |
| Brussels, BE | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Claremont, US | 1 |
| Université de Bordeauxlocation not on record | 1 |
| Dublin, IE | 1 |
| UEMAlocation not on record | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| UFPRlocation not on record | 1 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 1 |
| Beijing, CN | 1 |
| Centre National des Semences Forestièreslocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Limbe Botanical & Zoological Gardenslocation not on record | 1 |
| Botanical Garden "Anastasie Fatu" of Iasilocation not on record | 1 |
| EAlocation not on record | 1 |
| National Natural History Collectionslocation not on record | 1 |
| Institute for Agricultural Research of Mozambiquelocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| San Diego, US | 1 |
| INMAlocation not on record | 1 |
| UFVJMlocation not on record | 1 |
| IECOSlocation not on record | 1 |
| VALElocation not on record | 1 |
| Ilhéus, BR | 1 |
| UTFPR-SLlocation not on record | 1 |
| Zlocation not on record | 1 |
156 institutions · 1 857 of 2 021 vouchered records shown · 164 without an institution code
09Environmental DNA7 detections
Where the DNA of Schwenckia americana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found7
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 7 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.0 °C 23.1–24.9
Seasonal swing summer↔winter2.20 °C
Max temp (day)26.3 °C 26.0–26.6
Min temp (night)21.8 °C 20.2–23.4
Precipitation159 mm/mo 114–205
Air humidity68.6 % 68.0–69.2
Moisture balance26.4 mm/mo -20.2–73.1
Vapour deficit934 Pa 865–1,003
Wind speed4.30 m/s 4.00–4.60
Cloud cover31.5 % 30.9–32.0
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.