Schumanniophyton problematicum

(A.Chev.) Aubrév. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Schumanniophyton

At a glance

Occurrence records36

Data sources11

Biological traits11

DNA specimens4

eDNA detections2

Sources11 archives

Databases and archives Schumanniophyton problematicum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility36 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Chemical compositionLOTUS9 compounds

Occurrence & distributionGBIF36 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Schumanniophyton problematicum is a species of plant in the family Rubiaceae. It is found in Ivory Coast, Ghana, and Sierra Leone. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology2

Plant height max12.19 m

Plant height min6.1 m

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

03Chemical composition9 compounds

Compounds documented for Schumanniophyton problematicum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Chromones7

Pyridine alkaloids1

Simple coumarins1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(4S)-4-(5,7-dihydroxy-2-methyl-4-oxochromen-6-yl)-1-methylpiperidin-2-one	present	LOTUS
(4S)-4-(5,7-dihydroxy-2-methyl-4-oxochromen-6-yl)piperidin-2-one	present	LOTUS
14-Methyl-9,13-dioxa-5-azatetracyclo[8.8.0.02,7.012,17]octadeca-1,3,6,10,12(17),14-hexaene-8,16,18-trione	present	LOTUS
8,12-Dihydroxy-4-methyl-3,11-dioxa-15-azatetracyclo[8.8.0.02,7.013,18]octadeca-1(10),2(7),4,8-tetraene-6,14-dione	present	LOTUS
Noreugenin	present	LOTUS
Rohitukine	present	LOTUS
Scopoletin	present	LOTUS
Trigonelline	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Schumanniophyton problematicum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMN366593.1 ↗528 bp

ACGT

GTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACCAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCG …

Schumanniophyton problematicum voucher IDRCG322-13_WH213a_130 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Schumanniophyton problematicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-ipcn65

CCDB · book-ipcn65 — Mangenot & M. 1962

08Occurrence & distribution

Record type36 records

Wild obs. + sensor7

Museum / vouchered29

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤1 km 1>10 km 1

2 georeferenced · 5 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 29 records without

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
IBANNlocation not on record	12
CNF-UFHBlocation not on record	5
Daubeny Herbarium, Oxfordlocation not on record	2
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	1

4 institutions · 20 of 29 vouchered records shown · 9 without an institution code

09Environmental DNA2 detections

Where the DNA of Schumanniophyton problematicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.4 °C 26.7–28.1

Seasonal swing summer↔winter3.10 °C

Max temp (day)31.8 °C 31.5–32.1

Min temp (night)24.1 °C 23.1–25.0

Precipitation52.8 mm/mo 29.4–76.1

Air humidity65.6 % 63.6–67.5

Moisture balance-92.6 mm/mo -122–-63.2

Vapour deficit1,263 Pa 1,142–1,384

Wind speed2.90 m/s 2.70–3.00

Cloud cover15.8 % 15.8–15.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)