Schrebera trichoclada

Welw. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Oleaceae/Schrebera

At a glance

Occurrence records426

Data sources9

Biological traits21

DNA specimens9

eDNA detections4

Sources9 archives

Databases and archives Schrebera trichoclada's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility426 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF426 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 46

01Narrative

Schrebera trichoclada, the wing-leaved wooden pear, is a plant in the family Oleaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height6 m

Plant height max10 m

Plant height min2 m

Seed mass53.95 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max975 m

Elevation min30 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTforest

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density801 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Schrebera trichoclada has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences9

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOK244403.1 ↗6 729 bp

ACGT

CGTGCGCGGCATCGTAGTACGTGCTCACAACTGCGACCGCCGTCGGGTTGCAAACGCACGCGGCACGTTTCGGCCCCCTGCCAACACGGG …

Schrebera trichoclada voucher MO:T.B. Hart 1544 external transcribed spacer, partial sequence; 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S large subunit ribosomal RNA gene, complete sequence; and external transc

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK1★rbcL5★rbcLa★ITS3

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Schrebera trichoclada carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 46 n = 23

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 461×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BRIGGS, B.G. 1970. Some chromosome numbers in the Oleaceae. Contr. New South Wales Natl. Herb. 4: 126-129.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type426 records

Wild obs. + sensor25

Museum / vouchered296

Cultivated / captive105

Range

Area of Occupancy AOO736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 8≤1 km 3≤10 km 1

12 georeferenced · 13 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 1≤10 km 2>10 km 1

4 georeferenced · 292 without coordinates

Open the institutions mapphysical evidence296

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy63% within 1 km

≤100 m 62≤1 km 4≤10 km 30>10 km 9

105 georeferenced

Open the mapnot free-living105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	71
MeiseBGlocation not on record	38
Kew, GB	25
Instituto de Investigação Científica Tropicallocation not on record	23
TAFORI-LSRClocation not on record	16
Adam Mickiewicz University in Poznańlocation not on record	15
Pretoria, ZA	13
Plocation not on record	11
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	10
MAlocation not on record	4
Arusha, TZ	4
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	4
South Kensington, GB	3
Uppsala, SE	3
University of Johannesburglocation not on record	3
Paris, FR	2
DSMlocation not on record	2
Bronx, US	2
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	2
Xiamen, CN	1
Llocation not on record	1
Southern Highlands Conservation Programmelocation not on record	1
Addis Ababa, ET	1
Chongqing Museumlocation not on record	1
Dover, US	1
WAGlocation not on record	1
Glocation not on record	1
Stockholm, SE	1
University of Stellenboschlocation not on record	1
Buffelskloof Private Nature Reserve, Herbariumlocation not on record	1
EAlocation not on record	1
TFDlocation not on record	1
UJlocation not on record	1

33 institutions · 265 of 296 vouchered records shown · 31 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Schrebera trichoclada was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 21.4–26.0

Seasonal swing summer↔winter6.70 °C

Max temp (day)28.8 °C 25.8–30.0

Min temp (night)22.3 °C 17.4–22.8

Precipitation169 mm/mo 65.2–187

Air humidity63.7 % 61.8–65.8

Moisture balance22.8 mm/mo -34.3–50.7

Vapour deficit1,142 Pa 936–1,250

Wind speed1.60 m/s 1.20–1.80

Cloud cover49.3 % 22.5–61.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)