Schrebera swietenioides

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Oleaceae/Schrebera

At a glance

Occurrence records51

Data sources11

Biological traits17

DNA specimens3

eDNA detections2

Sources11 archives

Databases and archives Schrebera swietenioides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility51 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionDukesPhytochem1 compounds

Occurrence & distributionGBIF51 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 46

01Narrative

Schrebera swietenioides is a flowering plant in the family Oleaceae found in India, Bangladesh, Myanmar, Thailand, Cambodia and Laos. It prefers dry forests. It is commonly known as weaver's beam tree. Other names are mala plasu, muskkakavrksam, maggamaram', manimaram, mushkakavriksham, malamplasu and malamblasu. Flowering season is from February to April.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height15 m

Seed mass159 mg

Seed mass max159 mg

Seed mass min159 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density754 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Schrebera swietenioides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
BETULINIC-ACID		present	DukesPhytochem

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Schrebera swietenioides has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOK244402.1 ↗7 201 bp

ACGT

GGAGGACCAAGGCGTGGGCACCGAAATAAACATTGTCGTGGGATAGTGCGTGCGGCGCCCCTCGGGCGCGGCGTGCAAGGCAATGGATCG …

Schrebera swietenioides voucher MO:C.F. van Beusekom 3815 external transcribed spacer, partial sequence; 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S large subunit ribosomal RNA gene, complete sequence; and exter

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL3★ITS1

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Schrebera swietenioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 46 n = 23

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 461×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Bir, S.S., Gill, B.S. & Bedi, Y.S. 1979

n 233×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Bedi, Y. S. & S. S. Bir. 1985. Cytological observations on certain woody members of family Oleaceae. New Bot. 12: 135–141.

CCDB · ipcn-api-dl — Gill, B. S., V. K. Singhal, Y. S. Bedi & S. S. Bir. 1990. Cytological evolution in the woody taxa of Pachmarhi Hills. J. Cytol. Genet. 25: 308–320.

CCDB · ipcn-api-dl — Bir, S. S., B. S. Gill & Y. S. Bedi. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 402–403.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type51 records

Wild obs. + sensor23

Museum / vouchered28

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 6≤1 km 6≤10 km 6

18 georeferenced · 5 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 15

15 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	9
Baroda, IN	7
Gujarat Biodiversity Gene Banklocation not on record	2
Kew, GB	1

4 institutions · 19 of 28 vouchered records shown · 9 without an institution code

09Environmental DNA2 detections

Where the DNA of Schrebera swietenioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.4 °C 23.1–23.7

Seasonal swing summer↔winter12.3 °C

Max temp (day)28.2 °C 26.4–30.0

Min temp (night)18.6 °C 16.2–20.9

Precipitation130 mm/mo 26.8–234

Air humidity60.5 % 47.7–73.4

Moisture balance4.90 mm/mo -97.6–107

Vapour deficit1,126 Pa 775–1,476

Wind speed5.80 m/s 3.20–8.30

Cloud cover19.8 % 15.6–23.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)