Schoenocaulon officinale

(Schltdl. & Cham.) A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Melanthiaceae/Schoenocaulon

At a glance

Occurrence records146

Data sources12

Biological traits11

DNA specimens24

eDNA detections14

Sources12 archives

Databases and archives Schoenocaulon officinale's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility146 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS · NPASS118 compounds

Occurrence & distributionGBIF146 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD · NCBI24 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Schoenocaulon officinale, called sabadilla, is a species of flowering plant in the genus Schoenocaulon, native to Mexico, Central America, and Venezuela. It is highly toxic, containing veratridine, cevadine, and other alkaloids. Its seeds were used by pharmacists around the world to prepare delousing solutions and insecticides. It is still collected and used locally to rid domestic animals of fleas, ticks, lice and other parasites, and attempts are being made to revive the industry.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height1 m

Life cycle & reproduction2

Life formbulbous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition118 compounds

Compounds documented for Schoenocaulon officinale across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Monomeric stilbenes14

Chalcones9

Flavonols8

Wax monoesters7

Aurones6

Documented compounds118 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Kobusin	present	NPASS
(-)-Matairesinol	present	NPASS
(2e)-7-Phenylhepta-2-en-4,6-diyn-1-yl acetate	present	NPASS
(2R)-7-phenylhepta-4,6-diyne-1,2-diol	present	NPASS
(2R,3R,4S,5R,6S)-2-(hydroxymethyl)-6-[4-[(E)-2-[3-hydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]ethenyl]phenoxy]oxane-3,4,5-triol	present	LOTUS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(2R)-1-hydroxytrideca-5,7,9,11-tetrayn-2-yl]oxyoxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,2R)-1-hydroxytridec-5-en-7,9,11-triyn-2-yl]oxyoxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,3R)-1-hydroxytetradec-6-en-8,10,12-triyn-3-yl]oxyoxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,3S)-3-hydroxytetradec-6-en-8,10,12-triynoxy]oxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[[5-(2-phenylethynyl)thiophen-2-yl]methoxy]oxane-3,4,5-triol	present	NPASS

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Schoenocaulon officinale has left across the world's sequence archives.

At a glance

DNA specimens24

Marker genes4

GenBank sequences10

eDNA detections14

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJQ592639.1 ↗551 bpCosta Rica · 2009

ACGT

AGTGCTGGATTCAAAGCCGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACAAAACCAAAGATACTGATATCTTGGCAGCA …

Schoenocaulon officinale voucher BioBot01095 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL6★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Schoenocaulon officinale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type146 records

Wild obs. + sensor11

Museum / vouchered134

Other1

Range

Area of Occupancy AOO372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 3≤1 km 1≤10 km 3

7 georeferenced · 4 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 74≤1 km 2≤10 km 6>10 km 1

83 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence134

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	27
Mexico City, MX	22
Austin, US	11
Tuxtla Gutiérrez, MX	6
Altos de Pipe, VE	6
Chapingo, MX	5
Ciudad de México, MX	5
Austin, US	5
Antiguo Cuscatlán, SV	4
Area de Conservacion Guanacastelocation not on record	4
NO DISPONIBLElocation not on record	3
Adam Mickiewicz University in Poznańlocation not on record	3
Museo Nacional de Costa Rica (MNCR)location not on record	3
Ann Arbor, US	3
University of Stellenboschlocation not on record	3
Tuxtla Gutiérrez, MX	2
Toluca, MX	2
MAlocation not on record	2
Kew, GB	2
Berlin, DE	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Bronx, US	1
Tapachula, MX	1
Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record	1
San Francisco, US	1
South Kensington, GB	1
Mexico City, MX	1
RBGlocation not on record	1

28 institutions · 127 of 134 vouchered records shown · 7 without an institution code

09Environmental DNA14 detections

Where the DNA of Schoenocaulon officinale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 25.2–25.2

Seasonal swing summer↔winter2.00 °C

Max temp (day)27.1 °C

Min temp (night)23.7 °C

Precipitation345 mm/mo

Air humidity71.3 %

Moisture balance199 mm/mo

Vapour deficit915 Pa

Wind speed2.60 m/s

Cloud cover42.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)