Schizocosa crassipes

(Walckenaer, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Schizocosa

At a glance

Occurrence records155

Data sources9

Biological traits0

DNA specimens22

eDNA detections21

Sources9 archives

Databases and archives Schizocosa crassipes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility155 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF155 records

Environmental DNA1 datasets · 1 countries21 detections

DNA & barcodingBOLD22 specimens

Genome at a glanceGoaT2n = 22

01Narrative

Schizocosa crassipes is a species of wolf spider in the family Lycosidae. It is found in the United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Schizocosa crassipes has left across the world's sequence archives.

At a glance

DNA specimens22

BINs2

Marker genes1

eDNA detections21

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

7Amostly conserved

40Gmostly conserved

58Amostly conserved

70Amostly conserved

82Tmostly conserved

88Gmostly conserved

112Gvariable

145Amostly conserved

199Amostly conserved

313Amostly conserved

337Amostly conserved

364Tmostly conserved

369Cvariable

382Gvariable

397Tmostly conserved

469Avariable

472Amostly conserved

478Avariable

520Amostly conserved

526Tmostly conserved

532Gmostly conserved

571Tmostly conserved

583Amostly conserved

616Cvariable

625Gmostly conserved

631Tmostly conserved

TACTTTATATTTAATATTTGGTGTTTGATCTGCAATATTGGGAACTGCTATAAGTGTATTAATTCGAATAGAATTAGGTAATTCTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes9

BINs2

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gladicosa gulosasame family4.7%Schizocosa bilineatasame genus4.9%Schizocosa crassipalpatasame genus5.0%Schizocosa humilissame genus5.2%Schizocosa saltatrixsame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Schizocosa crassipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type155 records

Wild obs. + sensor29

Museum / vouchered126

Range

Area of Occupancy AOO240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 14≤1 km 2≤10 km 4>10 km 2

22 georeferenced · 7 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 69≤1 km 5≤10 km 15>10 km 8

97 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence126

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	102
Cincinnati, US	9
Chicago, US	5
Cambridge, US	3
US	2
Champaign, US	2
Centre for Biodiversity Genomicslocation not on record	1
Chicago, US	1

8 institutions · 125 of 126 vouchered records shown · 1 without an institution code

09Environmental DNA21 detections

Where the DNA of Schizocosa crassipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 18.8–25.7

Seasonal swing summer↔winter11.6 °C

Max temp (day)26.0 °C 24.6–31.0

Min temp (night)15.1 °C 14.6–20.8

Precipitation95.3 mm/mo 87.0–127

Air humidity57.4 % 56.4–58.8

Moisture balance-44.0 mm/mo -94.7–16.7

Vapour deficit1,022 Pa 952–1,379

Wind speed4.40 m/s 2.00–4.40

Cloud cover35.8 % 29.7–38.0

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)