Schistura notostigma

(Bleeker, 1863) · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Nemacheilidae/Schistura

At a glance

Occurrence records104

Data sources8

Biological traits5

DNA specimens98

eDNA detections5

Sources8 archives

Databases and archives Schistura notostigma's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility104 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics98 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF104 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD98 specimens

01Narrative

Schistura notostigma, the spotback loach, is a species of ray-finned fish in the genus Schistura, distributed in peninsula of India and Sri Lanka. Until 2017, it was thought to be the only species of Schistura stone loach found in Sri Lanka before a new species Schistura madhavai, was described.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length6.31 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability10

05DNA & barcoding98 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Schistura notostigma has left across the world's sequence archives.

At a glance

DNA specimens98

BINs16

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P627 bp consensus98 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 79 variable positions, in barcode order

9Cmostly conserved

27Tmostly conserved

30Amostly conserved

36Amostly conserved

39Amostly conserved

45Amostly conserved

48Gmostly conserved

60Amostly conserved

85Amostly conserved

93Cmostly conserved

96Amostly conserved

126Amostly conserved

129Gmostly conserved

132Cmostly conserved

138Gvariable

141Tvariable

144Gvariable

162Gvariable

165Gmostly conserved

168Amostly conserved

169Cmostly conserved

180Tvariable

186Tvariable

189Tmostly conserved

201Gmostly conserved

207Amostly conserved

210Cmostly conserved

234Gmostly conserved

243Tmostly conserved

249Amostly conserved

255Amostly conserved

264Cmostly conserved

267Cmostly conserved

270Amostly conserved

273Gvariable

276Cmostly conserved

288Amostly conserved

291Gmostly conserved

306Gmostly conserved

309Tvariable

318Gmostly conserved

324Avariable

327Cmostly conserved

336Cvariable

339Amostly conserved

372Gmostly conserved

381Tvariable

391Tmostly conserved

393Amostly conserved

396Tvariable

405Tvariable

417Amostly conserved

423Tvariable

426Tmostly conserved

441Cmostly conserved

442Gvariable

450Amostly conserved

456Amostly conserved

459Cmostly conserved

462Tmostly conserved

471Tmostly conserved

477Gvariable

480Tmostly conserved

495Tmostly conserved

513Avariable

516Cmostly conserved

534Tmostly conserved

549Gvariable

555Gmostly conserved

570Amostly conserved

579Cmostly conserved

591Tmostly conserved

594Gmostly conserved

597Tmostly conserved

600Tmostly conserved

603Cmostly conserved

606Tmostly conserved

612Gmostly conserved

618Cmostly conserved

GTCGGTACCGCTCTTAGTCTCCTAATTCGAGCTGAACTAAGTCAACCGGGGTCTCTTCTAGGCGATGACCAAATTTATAATGTAATTGTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 52 variants.

Diversity (π)4.2%

Haplotypes52

BINs16

Most divergent pair9.1%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Schistura dayisame genus9.7%Nemacheilus monilissame family10.5%Turcinoemacheilus bahaiisame family11.0%Schistura geislerisame genus11.6%Schistura pridiisame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_031585 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type104 records

Wild obs. + sensor14

Museum / vouchered90

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 14

14 georeferenced

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence90

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	1
	1

2 institutions · 2 of 90 vouchered records shown · 88 without an institution code

09Environmental DNA5 detections

Where the DNA of Schistura notostigma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 25.6–26.2

Seasonal swing summer↔winter1.50 °C

Max temp (day)28.6 °C 28.3–28.6

Min temp (night)23.7 °C 22.8–23.7

Precipitation230 mm/mo 230–232

Air humidity67.2 % 67.2–69.6

Moisture balance83.4 mm/mo 83.4–83.6

Vapour deficit1,112 Pa 995–1,112

Wind speed1.60 m/s 1.60–2.20

Cloud cover41.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)