Schismus barbatus
(L.) Thell. · speciesAt a glance
Occurrence records11 033
Data sources10
Biological traits48
DNA specimens31
eDNA detections18
Sources10 archives
Databases and archives Schismus barbatus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility11 033 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics31 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources48 traits
Occurrence & distributionGBIF11 033 records
Environmental DNA1 datasets · 3 countries18 detections
DNA & barcodingBOLD · NCBI31 specimens
Genome at a glanceCCDB2n = 12
01Narrative
Schismus barbatus é uma espécie de planta com flor pertencente à família Poaceae. A autoridade científica da espécie é (L.) Thell., tendo sido publicada em Bulletin de l'Herbier Boissier, sér. 2 7(5): 391. 1907.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology17
Fruit length0.66 mm
Inflorescence length max4 cm
Inflorescence length min1 cm
Leaf length100 mm
Leaf length max80 mm
Leaf size67 mm²
Leaf width1.5 mm
Leaf width max1 mm
Plant height0.275 m
⚠ sources differ — AusTraits: 0.275 m · TRY: 0.05 m
Plant height max0.4 m
Plant height min0.05 m
Seed mass0.079 mg
⚠ sources differ — TRY: 0.079 mg · AusTraits: 0.001 mg · GIFT: 0.06 mg
Seed mass max0.064 mg
Seed mass min0.056 mg
Seed volume0.048 mm³
Seed volume max0.048 mm³
Seed volume min0.048 mm³
Life cycle & reproduction9
Flower length max2.3 mm
Flower length min1 mm
Flowering endApr
Flowering startApr
Flowering timeyyyyyyyyyyyy
Life formannual
Life spanannual
Raunkiær life formtherophyte
Resprouting capacityfire_killed
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max2 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: H
Habitat GIFTsand
Leaf compoundnesssimple
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry6
Leaf C:N ratio16.25 g/g
Leaf c458 mg/g
Leaf dry-matter content (LDMC)312 mg/g
Leaf n29.0 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)14.87 mm²/mg
Other traits2
Inflorescencepanicle
Shoot orientationprostrate
05DNA & barcoding31 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Schismus barbatus has left across the world's sequence archives.
At a glance
DNA specimens31
Marker genes5
GenBank sequences10
eDNA detections18
Countries4
The DNA barcodea real sequence read deposited for this species
TCCCGCGAACCATCGAGTTTTTGNACGCAAGTTGCGCCCGAGGCCTTCTGGTCGAGGGCACGCCTGCCTGGGCGTCACGCCAAAAGACGC …
Schismus barbatus voucher EDNA15-0043122 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL4★rbcLa★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Schismus barbatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 12 n = 6
Ploidydiploid inferred
Chromosome records12–122n range12median12mode9records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 129×CCDB · nw-europe-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4650
CCDB · ipcn-api-dl — Scholz, H., C. Oberprieler & R. Vogt. 1998. Chromosome numbers of North African Phanerogams. VII. Some notes on North African Gramineae. Lagascalia 20(2): 265–275.
CCDB · book-ipcn67-71 — GOULD, F.W. 1970. In IOPB chromosome number reports XXV. Taxon 19: 102-113.
CCDB · eflora
CCDB · book-atlas-flowering-plants — Avdulov 1931
CCDB · CromoCat 2015 — Gould, F. W. (1970). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXV]. Taxon 19(1): 104-105.
CCDB · CromoCat 2015 — Scholz, H., C. Oberprieler & R. Vogt (1998). Chromosome numbers of North African Phanerogams. VII. Some notes on North African Gramineae Lagascalia 20(2): 265-275
n 614×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +4
CCDB · book-ipcn65 — Raven et al. 1965
CCDB · ipcn-api-dl — Faruqi, S. A., H. B. Quraish & M. Inamuddin. 1987. Studies in Libyan grasses X. Chromosome number and some interesting features. Ann. Bot. (Rome) 45: 75–102.
CCDB · ipcn-api-dl — Moinuddin, M., A. A. Vahidy & S. I. Ali. 1994. Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan. Ann. Missouri Bot. Gard. 81(4): 784–791.
CCDB · ipcn-api-dl — Roodt, R., J. J. Spies, A. F. Malan, F. Holder & S. M. C. v. Wyk. 2002. Chromosome studies on African plants 17. The subfamilies Arundinoideae and Danthonioideae. Bothalia 32(2): 233–240.
CCDB · ipcn-api-dl — Faruqi, S. A. & H. B. QURAISH. 1979. Studies on Libyan grasses. V. Population variability and distribution of Schismus arabicus and S. barbatus in Libya. Pakistan J. Bot. 11: 167–172.
CCDB · book-ipcn75-78 — Humphries 1978
CCDB · danthoinoides — (Roodt et al., 2002)
CCDB · danthoinoides — (Gould, 1958)
CCDB · Oberlander2016 — Gould, 1958;Faruqi, 1979;Roodt, 2002;Du Plessis, 1988
CCDB · Cave1958 — Gould 1958
CCDB · CromoCat 2015 — Plessis, H. & J. J. Spies. (1988). Chromosome studies on African plants. 8. Bothalia 18: 119-123.
CCDB · CromoCat 2015 — Faruqi, S. A. & Quraish, H. B. (1979). Studies on Libyan grasses. V. Population variability and distribution of Schismus arabicus and S. barbatus in Libya. Pakistan Journal of Botany 11: 167-172.
CCDB · CromoCat 2015 — Faruqi, S. A., Quraish, H. B. & Inamuddin, M. (1987). Studies in Libyan grasses X. Chromosome number and some interesting features Annali di Botanica 45: 75-102
CCDB · CromoCat 2015 — Moinuddin, M., A. A. Vahidy & S. I. Ali (1994). Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan Ann. Missouri Bot. Gard. 81(4): 784-791
n 122×CCDB · Oberlander2016 · CCDB · CromoCat 2015
CCDB · Oberlander2016 — Gould, 1958;Faruqi, 1979;Roodt, 2002;Du Plessis, 1988
CCDB · CromoCat 2015 — Plessis, H. & J. J. Spies. (1988). Chromosome studies on African plants. 8. Bothalia 18: 119-123.
n 182×CCDB · Oberlander2016 · CCDB · CromoCat 2015
CCDB · Oberlander2016 — Gould, 1958;Faruqi, 1979;Roodt, 2002;Du Plessis, 1988
CCDB · CromoCat 2015 — Plessis, H. & J. J. Spies. (1988). Chromosome studies on African plants. 8. Bothalia 18: 119-123.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type11 033 records
Wild obs. + sensor6 792
Museum / vouchered4 134
Other107
Origin
Native327
Introduced5 490
Range
Area of Occupancy AOO26 852 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy87% within 1 km
≤100 m 4 252≤1 km 606≤10 km 673>10 km 50
5 581 georeferenced · 1 211 without coordinates
Open the mapobservation + sensor6 792
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy57% within 1 km
≤100 m 504≤1 km 637≤10 km 701>10 km 158
2 000 georeferenced · 2 134 without coordinates
Open the institutions mapphysical evidence4 134
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions90 of 147 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Adelaide, AU | 562 |
| San Diego, US | 407 |
| Claremont, US | 392 |
| Pretoria, ZA | 308 |
| Riverside, US | 200 |
| ASUlocation not on record | 172 |
| Canberra, AU | 111 |
| Mount Annan, AU | 96 |
| Cape Town, ZA | 88 |
| Santa Barbara, US | 77 |
| Museo Entomologico de Leonlocation not on record | 72 |
| Phoenix, US | 69 |
| Flagstaff, US | 62 |
| València, ES | 59 |
| Logan, US | 58 |
| Davis, US | 52 |
| Kensington, AU | 51 |
| BClocation not on record | 47 |
| Irvine, US | 39 |
| CASlocation not on record | 38 |
| Kew, GB | 35 |
| San Luis Obispo, US | 30 |
| Alicante, ES | 30 |
| San Isidro, AR | 29 |
| Severin-McDaniel Insect Collectionlocation not on record | 27 |
| Brisbane, AU | 26 |
| Barcelona, ES | 25 |
| US | 25 |
| MAlocation not on record | 24 |
| Los Angeles, US | 22 |
| Bronx, US | 22 |
| Armidale, AU | 20 |
| EL PASO, US | 20 |
| Wlocation not on record | 18 |
| QAUlocation not on record | 18 |
| UChlocation not on record | 18 |
| PRClocation not on record | 18 |
| BDBClocation not on record | 17 |
| Granada, ES | 17 |
| Ensenada, MX | 16 |
| Austin, US | 16 |
| Arcata, US | 15 |
| John T. Waterhouse Herbariumlocation not on record | 14 |
| Edinburgh, GB | 14 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 14 |
| Saint Louis, US | 12 |
| Vitoria, ES | 12 |
| Northridge, US | 11 |
| MeiseBGlocation not on record | 11 |
| Canadian Department of Agriculturelocation not on record | 11 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 10 |
| Palmerston, AU | 10 |
| Mexico City, MX | 10 |
| University of Stellenboschlocation not on record | 10 |
| EEZA-CSIClocation not on record | 10 |
| Tampa, US | 10 |
| The University of Arizonalocation not on record | 9 |
| LDlocation not on record | 9 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 9 |
| Phyletisches Museum Jenalocation not on record | 9 |
| Long Beach, US | 8 |
| Cape Town, ZA | 8 |
| Moscow State Universitylocation not on record | 7 |
| Entomological Society of Latvialocation not on record | 7 |
| Pocatello, US | 6 |
| Ciudad Autónoma de Buenos Aires, AR | 6 |
| Arizona State University Biocollectionslocation not on record | 6 |
| San Bernardino, US | 6 |
| Hobart, AU | 6 |
| Wuzhou, CN | 6 |
| State Herbarium of South Australialocation not on record | 6 |
| Henderson, US | 5 |
| Mexico City, MX | 5 |
| Salamanca, ES | 5 |
| Orem, US | 5 |
| Dresden, DE | 5 |
| Sevilla, ES | 5 |
| Auckland, NZ | 4 |
| Albuquerque, US | 4 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 4 |
| Castelar, AR | 4 |
| Provo, US | 4 |
| La Paz, MX | 4 |
| Eastern Nevada Landscape Coalitionlocation not on record | 4 |
| Berlin, DE | 4 |
| Moscow, US | 4 |
| Denver, US | 4 |
| Boise, US | 3 |
| Universidad Nacional de La Pampalocation not on record | 3 |
| USFSlocation not on record | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Burlington, US | 3 |
| Durban, ZA | 3 |
| Angwin, US | 3 |
| Uppsala, SE | 3 |
| Zapopan, MX | 3 |
| Madrid, ES | 2 |
| Bangkok, TH | 2 |
| South Kensington, GB | 2 |
| Arizona Western Collegelocation not on record | 2 |
| Pamplona, ES | 2 |
| Córdoba, AR | 2 |
| Jaén, ES | 2 |
| Torreón, MX | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| San Jose, US | 2 |
| GZUlocation not on record | 2 |
| Hermosillo, MX | 2 |
| San Angelo, US | 2 |
| Fort Worth, US | 2 |
| Badajoz, ES | 2 |
| Universität Tübingenlocation not on record | 2 |
| Pullman, US | 2 |
| Vancouver, CA | 2 |
| Bloomington, US | 2 |
| Zürich, CH | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Frankfurt am Main | 1 |
| US | 1 |
| Chongqing Museumlocation not on record | 1 |
| Pittsburg, US | 1 |
| Clemson, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Bourges, FR | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| BRNUlocation not on record | 1 |
| UIBlocation not on record | 1 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 1 |
| MEXUlocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Austin, US | 1 |
| Toronto, CA | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| CJBGlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Durango, US | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| Smithfield, AU | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| BGPAlocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
147 institutions · 3 882 of 4 134 vouchered records shown · 250 without an institution code
09Environmental DNA18 detections
Where the DNA of Schismus barbatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found18
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 18 detections have coordinates
Open the map3 countries0
Coastal Sage Scrub/Ruderal vegetation with I…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.2 °C 11.2–21.1
Seasonal swing summer↔winter15.6 °C
Max temp (day)22.8 °C 17.0–27.2
Min temp (night)11.7 °C 7.80–14.9
Precipitation22.9 mm/mo 14.7–34.5
Air humidity48.3 % 44.0–59.7
Moisture balance-97.7 mm/mo -163–33.4
Vapour deficit989 Pa 673–1,401
Wind speed3.70 m/s 2.90–4.60
Cloud cover16.3 % 7.90–29.4
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.