Schinia septentrionalis

Walker, 1858 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Schinia

At a glance

Occurrence records163

Data sources5

Biological traits0

DNA specimens13

eDNA detections15

Sources5 archives

Databases and archives Schinia septentrionalis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility163 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF163 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD13 specimens

01Narrative

Schinia septentrionalis, the northern flower moth, is a moth of the family Noctuidae. The species was first described by Francis Walker in 1858. It is found in North America from Missouri to Quebec to South Carolina and Louisiana. Records include Colorado, Oklahoma, South Dakota and Texas. It is listed as threatened in the US state of Connecticut."Connecticut's Endangered, Threatened and Special Concern Species 2015". State of Connecticut Department of Energy and Environmental Protection Bureau of Natural Resources. Retrieved January 27, 2018. Male Female The wingspan is about 25 mm. There is one generation per year. The larvae feed on various asters including Symphyotrichum laeve, and Symphyotrichum oblongifolium.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Schinia septentrionalis has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections15

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

160Avariable

220Tvariable

403Cvariable

508Gmostly conserved

553Tvariable

625Tmostly conserved

628Avariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.43%

Haplotypes4

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Schinia ultimasame genus2.6%Schinia erranssame genus3.3%Schinia sirensame genus3.5%Schinia nubilasame genus3.5%Schinia jaegerisame genus3.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type163 records

Wild obs. + sensor59

Museum / vouchered104

Range

Area of Occupancy AOO352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy2% within 1 km

≤1 km 1≤10 km 5>10 km 53

59 georeferenced

Open the mapobservation + sensor59

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 1≤1 km 6≤10 km 60>10 km 21

88 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence104

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	49
Colorado State Universitylocation not on record	16
East Lansing, US	9
US	9
Washington, US	4
Philadelphia, US	3
St. Paul, US	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Mississippi State, US	1
WIlocation not on record	1
OSUClocation not on record	1
Georgia Museum of Natural Historylocation not on record	1

12 institutions · 99 of 104 vouchered records shown · 5 without an institution code

09Environmental DNA15 detections

Where the DNA of Schinia septentrionalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median0 °C 0–16.0

Seasonal swing summer↔winter21.2 °C

Max temp (day)2.80 °C 2.80–21.9

Min temp (night)-3.00 °C -3.00–11.9

Precipitation102 mm/mo 35.2–102

Air humidity59.3 % 50.4–61.5

Moisture balance71.7 mm/mo

Vapour deficit251 Pa 251–821

Wind speed4.00 m/s

Cloud cover45.5 % 26.8–45.5

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)