Sceliphron spirifex

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Sphecidae/Sceliphron

At a glance

Occurrence records2 201

Data sources7

Biological traits0

DNA specimens12

eDNA detections12

Sources7 archives

Databases and archives Sceliphron spirifex's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 201 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 201 records

Environmental DNA1 datasets · 5 countries12 detections

DNA & barcodingBOLD12 specimens

01Narrative

A Mediterranean house gecko in ambush on a nest of a Sceliphron spirifex. A Sceliphron spirifex offspring emerges from the nest. Sceliphron spirifex is a species of sphecid wasp. It has a medium-sized body (17 -), which is dull black with a long, yellow petiole (waist). The legs are black with yellow bands, the antennae are black and the wings are clear. Females build large multi-celled mud nests attached to cliffs, rocks, tree trunks, bridges and buildings. The cells are mass-provisioned with several spiders and sealed with mud. S. spirifex lives in diverse habitats across Africa and Southern Europe, but is strongly associated with buildings and other man-made structures.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sceliphron spirifex has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections12

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

139Cmostly conserved

433Amostly conserved

AACCTTATATTTTATTTTTGCTATATGAAGAGGAATAATAGGATCAGCTTTAAGAATAATAATTCGTATAGAATTAGGAACTCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.05%

Haplotypes3

BIN1

Most divergent pair0.30%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sceliphron destillatoriumsame genus7.6%Sceliphron laetumsame genus8.8%Sceliphron fistulariumsame genus9.9%Sceliphron madraspatanumsame genus10.0%Sceliphron curvatumsame genus10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 201 records

Wild obs. + sensor1 572

Museum / vouchered629

Origin

Native5

Range

Area of Occupancy AOO5 344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 774≤1 km 239≤10 km 90>10 km 47

1 150 georeferenced · 422 without coordinates

Open the mapobservation + sensor1 572

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 1≤1 km 18≤10 km 78>10 km 10

107 georeferenced · 522 without coordinates

Open the institutions mapphysical evidence629

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	343
Muzeum Górnośląskie w Bytomiulocation not on record	137
Zürich, CH	80
NMOKlocation not on record	10
Bonn, DE	7
Durban Natural Science Museumlocation not on record	6
Cape Town, ZA	6
SAMClocation not on record	6
Provincia di Livornolocation not on record	4
Natural History Museum Rotterdamlocation not on record	4
IMEDEAlocation not on record	3
Philadelphia, US	3
Copenhagen, DK	2
Banyoles, ES	1
UGRlocation not on record	1
Paris, FR	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
Auckland, NZ	1

18 institutions · 616 of 629 vouchered records shown · 13 without an institution code

09Environmental DNA12 detections

Where the DNA of Sceliphron spirifex was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 21.0–25.6

Seasonal swing summer↔winter12.6 °C

Max temp (day)25.8 °C 22.8–29.1

Min temp (night)22.2 °C 19.2–23.1

Precipitation8.30 mm/mo 0.1–112

Air humidity64.6 % 60.9–68.2

Moisture balance-143 mm/mo

Vapour deficit972 Pa 935–1,201

Wind speed3.20 m/s

Cloud cover26.1 % 8.10–40.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sceliphron spirifex

At a glance

Sources7 archives

At a glance

Record type2 201 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 201 records