Sapyga quinquepunctata

(Fabricius, 1781) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Sapygidae/Sapyga

At a glance

Occurrence records3 620

Data sources7

Biological traits2

DNA specimens34

eDNA detections27

Sources7 archives

Databases and archives Sapyga quinquepunctata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 620 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 620 records

Environmental DNA1 datasets · 11 countries27 detections

DNA & barcodingBOLD34 specimens

01Narrative

Sapyga quinquepunctata is a species of sapygid wasp. It is a parasite of mason bees.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)parasitoid

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sapyga quinquepunctata has left across the world's sequence archives.

At a glance

DNA specimens34

BINs2

Marker genes1

eDNA detections27

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

5Tmostly conserved

67Tmostly conserved

74Tmostly conserved

79Amostly conserved

82Tmostly conserved

85Tmostly conserved

103Tmostly conserved

106Tmostly conserved

145Tmostly conserved

166Amostly conserved

172Tmostly conserved

184Amostly conserved

200Amostly conserved

202Tmostly conserved

205Amostly conserved

217Gmostly conserved

247Tmostly conserved

259Cmostly conserved

266Tmostly conserved

271Cmostly conserved

295Cmostly conserved

301Tmostly conserved

304Tmostly conserved

340Cvariable

343Cmostly conserved

352Tmostly conserved

370Tmostly conserved

373Cvariable

376Tmostly conserved

385Tmostly conserved

388Cmostly conserved

412Gmostly conserved

418Tmostly conserved

427Tmostly conserved

433Gvariable

445Tmostly conserved

451Tmostly conserved

475Cmostly conserved

496Amostly conserved

497Tmostly conserved

523Amostly conserved

533Cmostly conserved

556Tmostly conserved

562Tmostly conserved

634Cvariable

640Tmostly conserved

AATATTATATTTTATTTTTGCAATATGAGCTGGAATAATTGGAAGATCAATAAGTATAATTATTCGTACTGAATTAGGAACTCCTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes12

BINs2

Most divergent pair6.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sapyga similissame genus10.9%Monosapyga clavicornissame family13.2%Sapygina decemguttatasame family13.2%Sapyga louisisame genus13.5%Krombeinopyga pumilasame family13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 620 records

Wild obs. + sensor2 102

Museum / vouchered1 496

Cultivated / captive6

Other16

Origin

Native394

Range

Area of Occupancy AOO6 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 994≤1 km 218≤10 km 671>10 km 31

1 914 georeferenced · 188 without coordinates

Open the mapobservation + sensor2 102

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 67≤1 km 292≤10 km 975>10 km 40

1 374 georeferenced · 122 without coordinates

Open the institutions mapphysical evidence1 496

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	296
Provincia di Livornolocation not on record	288
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	166
Paro, BT	154
Bern, CH	124
Geneva, CH	78
Philadelphia, US	56
SLU Artdatabankenlocation not on record	37
Natural History Museum Rotterdamlocation not on record	30
NMOKlocation not on record	26
Muzeum Górnośląskie w Bytomiulocation not on record	15
Adam Mickiewicz University in Poznańlocation not on record	12
ZSMlocation not on record	9
Bonn, DE	9
Trondheim, NO	6
UGRlocation not on record	6
Frauenfeld, CH	6
South Kensington, GB	6
Bavarian State Collection of Zoologylocation not on record	5
Uniwersytet Łódzkilocation not on record	3
CBDClocation not on record	3
BioFokuslocation not on record	2
Musee d'Histoire Naturallelocation not on record	2
neflocation not on record	2
Natural History Museum, Londonlocation not on record	2
Gothenburg, SE	2
IMEDEAlocation not on record	2
WIlocation not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
Stockholm, SE	1
NCMGlocation not on record	1

31 institutions · 1 351 of 1 496 vouchered records shown · 145 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA27 detections

Where the DNA of Sapyga quinquepunctata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries11

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map11 countries0

ChenaieGardenMaquis

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 12.0–18.6

Seasonal swing summer↔winter18.4 °C

Max temp (day)19.1 °C 15.8–23.1

Min temp (night)11.1 °C 7.80–13.4

Precipitation60.8 mm/mo 33.9–118

Air humidity57.9 % 54.2–62.6

Moisture balance-55.6 mm/mo -119–-14.3

Vapour deficit750 Pa 523–981

Wind speed2.70 m/s 1.50–4.80

Cloud cover35.7 % 33.7–42.3

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sapyga quinquepunctata

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type3 620 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 31 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 620 records