Sanguisorba officinalis
speciesAt a glance
Occurrence records243 268
Data sources17
Biological traits60
DNA specimens54
eDNA detections36
Sources17 archives
Databases and archives Sanguisorba officinalis's data was compiled from.
WikipediaWikimedia Foundation13 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility243 268 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics54 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources60 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS190 compounds
Occurrence & distributionGBIF243 268 records
Environmental DNA1 datasets · 6 countries36 detections
DNA & barcodingBOLD · NCBI54 specimens
Genome at a glanceCCDB · GoaT2n = 28
01Narrative
The dry fruits contain the achenes which contain the seeds Sanguisorba officinalis, commonly known as great burnet, is a plant in the family Rosaceae, subfamily Rosoideae. It is native throughout the cooler regions of the Northern Hemisphere in Europe, northern Asia, and northern North America. It is a herbaceous perennial plant growing to 1 m tall, which occurs in grasslands, growing well on grassy banks. It flowers June or July. Sanguisorba officinalis is an important food plant for the European large blue butterflies Phengaris nausithous and P. teleius.World Conservation Monitoring Centre 1996. . Downloaded on 6 October 2010
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology18
Inflorescence length max3 cm
Inflorescence length min1 cm
Leaf length40 mm
Leaf length max70 mm
Leaf length min10 mm
Leaf mass121 mg
Leaf size3 254 mm²
⚠ sources differ — TRY: 3 254 mm² · LEDA: 2 641 mm² · GIFT: 2 373 mm²
Leaf width17.5 mm
Leaf width max30 mm
Leaf width min5 mm
Plant height0.613 m
⚠ sources differ — GIFT: 0.613 m · LEDA: 0.475 m · TRY: 0.32 m
Plant height generative0.281 m
Plant height max1.2 m
Plant height min0.2 m
Seed length3.02 mm
Seed mass2.14 mg
⚠ sources differ — TRY: 2.14 mg · LEDA: 2.26 mg · GIFT: 2.21 mg
Seed mass max2.86 mg
Seed mass min0.69 mg
Life cycle & reproduction15
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: anemochorous
Flowering endSep
Flowering startJun
Life formperennial
Life spanperennial
Lifespan years14 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: phanerophyte
Reproduction asexualabsent
Seed number5 150
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation mean1 515 m
Elevation min30 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTforest edges, meadows, meadows: dry, mountains, rivers, shrubberies, swamps
Leaf formcordate-lanceolate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio15.89 g/g
Leaf c415 mg/g
Leaf dry-matter content (LDMC)311 mg/g
⚠ sources differ — TRY: 311 mg/g · LEDA: 289 mg/g
Leaf n19.33 mg/g
Leaf p1.44 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)13.65 mm²/mg
⚠ sources differ — TRY: 13.65 mm²/mg · LEDA: 21.4 mm²/mg · GIFT: 22.01 mm²/mg
Other traits4
Diaspore typegenerative dispersule
Leaf margintoothed
Leaf spinesno
Leaf thornsno
03Chemical composition190 compounds
Compounds documented for Sanguisorba officinalis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking💊 Medicinal use documented
Compound class profile5 classes
Ursane and Taraxastane triterpenoids40
Gallotannins35
Flavan-3-ols6
Flavones6
Flavonols6
Documented compounds190 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| TANNIN | 170,000 ppm | DukesPhytochem | |
| CATECHOL-TANINS | 170,000 ppm | DukesPhytochem | |
| FAT | 135,000 ppm | DukesPhytochem | |
| PROTEIN | 128,000 ppm | DukesPhytochem | |
| SANGUISORBIN | 40,000 ppm | DukesPhytochem | |
| SUGAR | 9,000 ppm | DukesPhytochem | |
| BETULINIC-ACID | 1,100 ppm | DukesPhytochem |
05DNA & barcoding54 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sanguisorba officinalis has left across the world's sequence archives.
At a glance
DNA specimens54
Marker genes6
GenBank sequences10
eDNA detections36
Countries7
The DNA barcodea real sequence read deposited for this species
ACACGTCGTTGCCCCCCCAACCCCTTCGTGGGTCGGACGGGACGGATGATGGCCTCCCGTGTGCTCCGTCACGCGGCTGGCATAAATACC …
Sanguisorba officinalis voucher ZX-9043 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★ITS5★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Sanguisorba officinalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidypolyploid inferred
Chromosome records14–562n range28median28mode79records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2841×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · iapt · CCDB · brit-fl +9
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · brit-fl — Nordborg, G. Bot. Not. 116: 267-288 (1963)
CCDB · fl-europaea — Nordborg, 1958
CCDB · ipcn-api-dl — Krogulevich, R. E. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.
CCDB · ipcn-api-dl — Yurtsev, B. A. & P. G. ZHUKOVA. 1982. Chromosome numbers of some plants of the northeastern Yakutia (the drainage of the Indigirka River in its middle reaches). Bot. Zhurn. 67 (6): 778–787. (In Russian).
CCDB · ipcn-api-dl — Ge, C. j., Y. k. Li, P. Wan & P. s. Hsu. 1989. Chromosome numbers of 31 medicinal plants from Shandong Province. Pp. 267--272 in D. Hong (editor), Plant Chromosome Research 1987.
CCDB · ipcn-api-dl — Oginuma, K. 1990. A cytological study on two species of Sanguisorba from western Japan. Bull. Coll. Child Developm. Kochi Women's Univ. 14: 87–92.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 265–268.
CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1981a. In Chromosome number reports LXX. Taxon 30: 70–72.
CCDB · ipcn-api-dl — Javurkova, V. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 400–401.
CCDB · ipcn-api-dl — Mishima, M., N. Ohmido, K. Fukui & T. Yahara. 2002. Trends in site-number change of rDNA loci during polyploid evolution in Sanguisorba (Rosaceae). Chromosoma 110(8): 550–558.
CCDB · ipcn-api-dl — Shatalova, S. A. 2000. Chromosome numbers in vascular plants of the Primorsky territory. Bot. Žhurn. (Moscow & Leningrad) 85(1): 152–156.
CCDB · book-ipcn66 — Zhukova 1966
CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.
CCDB · book-ipcn67-71 — SOKOLOVSKAYA, A.P. 1968. A karyological investigation Of the flora of the Korjakian Land. (In Russian) Bot. Zurn. 53: 99-105.
CCDB · book-ipcn67-71 — ZHUKOVA, P.G. 1969. Chromosome number in certain plant species indigenous to the north-east of the USSR. IV. Bot. Zurn. 54: 1985-1990.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — BORSOS, o. 1970. Contributions to the knowledge on the chromosome numbers of Phanerogams growing in Hungary and southeastern Europe. Acta Bot. Acad. Sci. Hung. 16: 255-265.
CCDB · book-ipcn75-78 — llelaeva & Siplivinsky 1975
CCDB · book-ipcn75-78 — Zhukova & Petrovsky 1976
CCDB · book-northern-plants — Nakajima 1936.
CCDB · book-ipcn73-74 — MULLIGAN, G.A., W.J. CODY. 1974. In IOPB chromosome number repel XLIII. Taxon 23: 193-196. - I
CCDB · book-atlas-flowering-plants — Nakajima 1936
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I., Isaikina, M. M. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:891-892
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
CCDB · CromoCat 2015 — Dawe, J. C. & Murray, D. F. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIII]. Taxon 28(1, 2/3): 265-268.
CCDB · CromoCat 2015 — Dawe, J. C. & Murray, D. F. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXX]. Taxon 30(1): 70-72.
CCDB · CromoCat 2015 — Ge, C.-j., Li, Y.-k., Wan, P. & Hsu, P.-s. (1989). Chromosome numbers of 31 medicinal plants from Shandong Province. Pp. 267--272 in D. Hong (editor), Plant Chromosome Research 1987.
CCDB · CromoCat 2015 — Javurková, V. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIV]. Taxon 28(4): 400-401.
CCDB · CromoCat 2015 — Krogulevich, R. E. (1984). In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk.
CCDB · CromoCat 2015 — Oginuma, K. (1990). A cytological study on two species of Sanguisorba from western Japan. Bulletin of College of Child Development, Kochi Women's University 14: 87-92.
CCDB · CromoCat 2015 — Probatova, N. S., Rudyka, E. G., Seledets, V. P. & Nechaev, V. A. (2008). IAPT/IOPB Chromosome Data 6 Taxon 57(4): 1267-1273
CCDB · CromoCat 2015 — Probatova, N. S., Seledets, V. P., Gnutikov, A. A. & Shatokhina, A. V. (2008). IAPT/IOPB Chromosome Data 6 Taxon 57(4): 1267-1273
CCDB · CromoCat 2015 — Yurtsev, B. A. & P. G. Zhukova. (1982). Chromosome numbers of some plants of the Northeastern Yakutia ( the Drainage of the Indigirka river in the its middle reaches). J. Bot. URSS 67(6): 778-787.
CCDB · CromoCat 2015 — Zhukova, P. G. (1980). Chromosome numbers of some southern Chukotka plant species. Bot. Žurn. 65: 51-59.
CCDB · CromoCat 2015 — Zhukova, P. G. (1982). Chromosome numbers of some north-eastern Asia plant species. Bot. Žurn. 67: 360-365.
+1 more references
2n 5630×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +7
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Murín A. & Májovský J., 1983: Karyological study of Slovakian flora IV. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 30: 1-16.
CCDB · slov-fl — Nordborg G., 1963: Studies in Sanguisorba officinalis L. - Bot. Not. 116/2: 267-288.
CCDB · brit-fl — Wentworth, J.E., Bailey, J.P., Gornall, R.J. Watsonia 18: 415-418 (1991)
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Irish Naturalists' J. : ()
CCDB · fl-europaea — Nordborg, 1958
CCDB · poland — Skali?ska M., Pogan E., Jankun A. et al. 1968. Further studies in chromosome numbers of Polish Angiosperms. Seventh contribution. Acta Biol. Cracov. Ser. Bot. 11, 199-224.
CCDB · ipcn-api-dl — Wentworth, J. E., J. P. Bailey & R. J. Gornall. 1991. Contributions to a cytological catalogue of the British and Irish flora, 1. Watsonia 18: 415–417.
CCDB · ipcn-api-dl — Krasnikov, A. A. 1991. Chromosome numbers in some species of vascular plants from Novosibirsk region. Bot. Žhurn. (Moscow & Leningrad) 76: 476–479.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1995. Chromosome numbers in some species of vascular plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 80(3): 85–88.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Gurzenkov, N. N. 1973. Studies of chromosome numbers of plants from the south of the Soviet Far East. Komarov Lectures. 20: 47–61.
CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Chromosome numbers of flowering plants in the Netherlands IV. Proc. Roy. Netherlands Acad. Sci. ser. C. 71: 168-183.
CCDB · book-ipcn67-71 — SKALINSKA, M., E. POGAN, & A. JANKUN. 1968. Further studies in chromosome numbers of Polish Angiosperms, VII. Acta Biol. Cracov. Ser. Bot. 11: 199-224.
CCDB · book-ipcn73-74 — GADELLA, T.W.J., & E. KLIPHUIS. 1973. Chromosome numbers of flowerinl plants in the Netherlands VI. Proc. Kon. Ned. Acad. Wet., ser. C 76: 303-311.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-fedorov — I'ypaeHKOB Heony6,T[.
CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart
CCDB · CromoCat 2015 — Hollingsworth, P. M., Gornall, R. J. & Bailey, J. P. (1992). Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134-137.
CCDB · CromoCat 2015 — Javurková, V. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIV]. Taxon 28(4): 400-401.
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — Krasnikov, A. A. (1991). Chromosome numbers in some species of vascular plants from Novosibirsk region. Bot. Žurn. 76: 476-479.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Mesí?ek, J. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesícek & V. Javurková-Jarolímová. Academia, Praha NONE LISTED
CCDB · CromoCat 2015 — Nordborg, G. (1963). Studies in Sanguisorba officinalis. Bot. Not. 116(2): 267-288.
CCDB · CromoCat 2015 — Probatova, N. S. & A. P. Sokolovskaya. (1995). Chromosome numbers in some species of vascular plants from the Russian Far East. Bot. Žurn. 80(3): 85-88.
CCDB · CromoCat 2015 — Wentworth, J. E., J. P. Bailey & R. J. Gornall. (1991). Contributions to a cytological catalogue of the British and Irish flora, 1. Watsonia 18: 415-417.
2n 426×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · Cave1956 +1
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Lippert, W. & G. R. Heubl. 1989. Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 2]. Ber. Bayer. Bot. Ges. 60: 73–83.
CCDB · book-ipcn75-78 — Krogulevich 1978
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Krogulevich, R. E. (1978a). Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19-48. Nauka, Novosibirsk.
CCDB · CromoCat 2015 — Lippert, W. & Heubl, G.R. (1989). Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 2]. Ber. Bayer. Bot. Ges. 60: 73-83.
2n 572×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
2n 141×CCDB · book-ipcn65
CCDB · book-ipcn65 — Zhukova 1965b
2n 261×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Krogulevich 1976
n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I., Isaikina, M. M. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:891-892
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
n 142×CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn73-74 — POJAR, J. 1973. Levels of polyploidy in four vegetation types of southwestern British Columbia. Canad. J. Bot. 51: 621-628. I
n 281×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Nordborg, G. (1963). Studies in Sanguisorba officinalis. Bot. Not. 116(2): 267-288.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~6.01 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin6.01 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type243 268 records
Wild obs. + sensor230 085
Museum / vouchered10 222
Cultivated / captive25
Other2 936
Origin
Native8 475
Introduced69
Range
Area of Occupancy AOO209 452 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy36% within 1 km
≤100 m 40 116≤1 km 17 767≤10 km 101 743>10 km 1 983
161 609 georeferenced · 68 476 without coordinates
Open the mapobservation + sensor230 085
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy30% within 1 km
≤100 m 353≤1 km 1 157≤10 km 3 341>10 km 224
5 075 georeferenced · 5 147 without coordinates
Open the institutions mapphysical evidence10 222
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy14% within 1 km
≤1 km 2≤10 km 12
14 georeferenced · 11 without coordinates
Open the mapnot free-living25
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions146 of 306 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 516 |
| Moscow State Universitylocation not on record | 746 |
| Beijing, CN | 553 |
| BFLlocation not on record | 481 |
| Olocation not on record | 194 |
| Yangling, CN | 181 |
| LDlocation not on record | 170 |
| Salzburg, AT | 165 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 141 |
| Shinshu Universitylocation not on record | 112 |
| Chiba, JP | 108 |
| MeiseBGlocation not on record | 108 |
| Nanjing, CN | 104 |
| Odawara, JP | 103 |
| Bergen, NO | 100 |
| Tartu, EE | 96 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 89 |
| Bando, JP | 85 |
| Adam Mickiewicz University in Poznańlocation not on record | 81 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 66 |
| Kunming, CN | 64 |
| Helsinki, FI | 59 |
| Karlsruhe, DE | 58 |
| Mlocation not on record | 57 |
| Bern, CH | 57 |
| BIO-UNIPIlocation not on record | 57 |
| Görlitz, DE | 56 |
| KR | 56 |
| Xining, CN | 51 |
| Beijing Normal Universitylocation not on record | 50 |
| Nagano City, JP | 48 |
| National Institute of Biological Resourceslocation not on record | 47 |
| Sanda, JP | 47 |
| KMNlocation not on record | 47 |
| Garðabær, IS | 45 |
| Guangzhou, CN | 44 |
| Tsukuba, JP | 44 |
| Sendai, JP | 41 |
| Wuhan, CN | 41 |
| Brussel, BE | 39 |
| Provincia di Livornolocation not on record | 37 |
| Guilin, CN | 36 |
| SXTCMlocation not on record | 35 |
| Uniwersytet Warszawskilocation not on record | 35 |
| Tomioka, JP | 35 |
| Kochi, JP | 34 |
| GJOlocation not on record | 34 |
| Tallinn, EE | 33 |
| BRNUlocation not on record | 33 |
| Northeastern Forestry Universitylocation not on record | 33 |
| Nagatoro-machi, Chichibu-gun, JP | 33 |
| MAlocation not on record | 32 |
| Entomological Society of Latvialocation not on record | 32 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 31 |
| Oskarshamn, SE | 31 |
| KURAlocation not on record | 30 |
| Fukushima Universitylocation not on record | 29 |
| Trondheim, NO | 28 |
| Toyama, JP | 28 |
| South Kensington, GB | 28 |
| Victoria, CA | 27 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 27 |
| Chengdu, CN | 27 |
| València, ES | 26 |
| Vitoria, ES | 26 |
| Berlin, DE | 25 |
| Tokushima, JP | 25 |
| Angwin, US | 23 |
| DMZ botanic gardenlocation not on record | 21 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 20 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 20 |
| Corvallis, US | 20 |
| JP | 19 |
| Universidad Católica de Santa Maríalocation not on record | 19 |
| Lanzhou, CN | 19 |
| Wlocation not on record | 18 |
| GZUlocation not on record | 17 |
| Oulu, FI | 17 |
| DBF-NHMDlocation not on record | 17 |
| Uppsala, SE | 17 |
| WTUlocation not on record | 16 |
| Shanghai, CN | 16 |
| SLU Artdatabankenlocation not on record | 15 |
| Inner Mongolia Universitylocation not on record | 14 |
| BClocation not on record | 14 |
| LfUlocation not on record | 14 |
| Xian, CN | 14 |
| Uniwersytet Opolskilocation not on record | 13 |
| ENTClocation not on record | 13 |
| Anhui Normal Universitylocation not on record | 13 |
| Shanxi Institute of Biologylocation not on record | 13 |
| Vancouver, CA | 13 |
| Hangzhou, CN | 13 |
| Pullman, US | 12 |
| Tianjin Natural History Museumlocation not on record | 12 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 12 |
| Uniwersytet Jagiellońskilocation not on record | 12 |
| Guangzhou, CN | 12 |
| Osaka, JP | 11 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 11 |
| Saint Louis, US | 11 |
| CICYTEXlocation not on record | 11 |
| NSMKlocation not on record | 10 |
| Kew, GB | 10 |
| Shanxi Universitylocation not on record | 10 |
| Servico de Microbiologia e Imunologialocation not on record | 10 |
| Voronezh State Universitylocation not on record | 10 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 9 |
| TROMlocation not on record | 9 |
| University of Stellenboschlocation not on record | 9 |
| JMSlocation not on record | 9 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 9 |
| Korea National Arboretumlocation not on record | 9 |
| Kyoto Universitylocation not on record | 9 |
| Omachi Alpine Museumlocation not on record | 9 |
| Taiyuan Normal Universitylocation not on record | 9 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 8 |
| San Sebastián, ES | 8 |
| Frankfurt am Main | 8 |
| Turku, FI | 8 |
| KIRMlocation not on record | 8 |
| Chengdu, CN | 8 |
| Bourges, FR | 8 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 8 |
| Zhengzhou, CN | 8 |
| Tula State Universitylocation not on record | 8 |
| Shanghai, CN | 8 |
| DNSMlocation not on record | 8 |
| PRClocation not on record | 7 |
| Frauenfeld, CH | 7 |
| Seoul, KR | 7 |
| Arcata, US | 7 |
| Yunnan Universitylocation not on record | 7 |
| CJBGlocation not on record | 7 |
| Whitehorse, CA | 7 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 7 |
| Porrentruy, CH | 7 |
| Stockholm, SE | 7 |
| Shenyang Agricultural Universitylocation not on record | 7 |
| KIWElocation not on record | 7 |
| BDBClocation not on record | 6 |
| Anchorage, US | 6 |
| J. Rusek Collectionlocation not on record | 6 |
| SZUlocation not on record | 6 |
| Salamanca, ES | 6 |
| IWEP FEB RASlocation not on record | 6 |
| Barcelona, ES | 6 |
| SMMUlocation not on record | 6 |
| Peking Universitylocation not on record | 6 |
| HUFDlocation not on record | 6 |
| Madrid, ES | 5 |
| Nagasaki University - Fisherieslocation not on record | 5 |
| Xiamen, CN | 5 |
| KOMlocation not on record | 5 |
| IMNUlocation not on record | 5 |
| Natural History Museum Rotterdamlocation not on record | 5 |
| Central China Normal Universitylocation not on record | 5 |
| Changsha, CN | 5 |
| Jiangxi College of Educationlocation not on record | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Wuzhou, CN | 5 |
| Cambridge, US | 5 |
| Tilburg, NL | 5 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 5 |
| Guiyang, CN | 4 |
| Beijing, CN | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Alicante, ES | 4 |
| UGentlocation not on record | 4 |
| National Museum Waleslocation not on record | 4 |
| Edinburgh, GB | 4 |
| Chongqing Museumlocation not on record | 4 |
| Dresden, DE | 4 |
| Otaru, JP | 4 |
| Fulda, DE | 4 |
| Santiago de Compostela, ES | 4 |
| J.F.Oberlin Universitylocation not on record | 4 |
| Zhejiang Museum of Natural Historylocation not on record | 4 |
| Durham, US | 4 |
| Pamplona, ES | 3 |
| Granada, ES | 3 |
| Bronx, US | 3 |
| Philadelphia, US | 3 |
| Chengdu, CN | 3 |
| Burlington, US | 3 |
| Akita Prefectural Museumlocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Tempe, US | 3 |
| Dekalb, US | 3 |
| Allentown, US | 3 |
| Kuopio, FI | 3 |
| KNAMlocation not on record | 3 |
| TUR-Alocation not on record | 3 |
| Namur, BE | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| 黔东南州民族医药研究所标本室location not on record | 3 |
| South China Normal Universitylocation not on record | 3 |
| Wellington, NZ | 3 |
| Nishihara, JP | 3 |
| CASlocation not on record | 3 |
| WNNUlocation not on record | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Urumqi, CN | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| University of Alberta Museumslocation not on record | 3 |
| CZE061location not on record | 3 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 3 |
| Portland, US | 3 |
| NMBU:MINAlocation not on record | 3 |
| Strecker Museum, Baylor Universitylocation not on record | 3 |
| Paris, FR | 3 |
| Jaén, ES | 3 |
| Gijón, ES | 2 |
| Cambridge, US | 2 |
| Sion, CH | 2 |
| BSBIlocation not on record | 2 |
| Wuhan, CN | 2 |
| DOI/NPS, Olympic National Parklocation not on record | 2 |
| Acadia Universitylocation not on record | 2 |
| Bureau of Land Management, Medford District Officelocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| nlocation not on record | 2 |
| Philadelphia, US | 2 |
| Guiyang, CN | 2 |
| Jyväskylä, FI | 2 |
| Madrid, ES | 2 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 2 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 2 |
| San Diego, US | 2 |
| Awka, NG | 2 |
| FLADlocation not on record | 2 |
| Hebei Normal Universitylocation not on record | 2 |
| H-Meierottlocation not on record | 2 |
| SJNAlocation not on record | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Taipei, TW | 2 |
| OLAlocation not on record | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Brookings, US | 2 |
| Taipei, TW | 2 |
| Xian, CN | 2 |
| Podgorica, ME | 2 |
| University of New Hampshirelocation not on record | 1 |
| Guiyang, CN | 1 |
| Tromso University Museumlocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Nishihara, JP | 1 |
| Lausanne, CH | 1 |
| Bratislava, SK | 1 |
| Moscow, US | 1 |
| Universität Göttingenlocation not on record | 1 |
| Oiso Municipal Museumlocation not on record | 1 |
| Christchurch, NZ | 1 |
| H-Resselocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Port Elizabeth Museum (Bayworld)location not on record | 1 |
| Arequipa, PE | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 1 |
| IMMUlocation not on record | 1 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 1 |
| Caldwell, US | 1 |
| Flagstaff, US | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Riverside, US | 1 |
| Yukon Universitylocation not on record | 1 |
| Dhaka, BD | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Chinese Academy of Forestrylocation not on record | 1 |
| FJIDClocation not on record | 1 |
| Kushiro City Museumlocation not on record | 1 |
| Guiyang, CN | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| PHlocation not on record | 1 |
| Mie Prefectural Museumlocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| San Jose, US | 1 |
| Boumlocation not on record | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| St. Paul, US | 1 |
| Minia, EG | 1 |
| IPE-CSIClocation not on record | 1 |
| Boise, US | 1 |
| Ashland, US | 1 |
| Bloomington, US | 1 |
| Denver, US | 1 |
| SIHUlocation not on record | 1 |
| Fribourg, CH | 1 |
| Philadelphia, US | 1 |
| Logan, US | 1 |
| Davis, US | 1 |
| Ivano-Frankove, UA | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Ann Arbor, US | 1 |
| Zürich, CH | 1 |
| ULBF-AGRlocation not on record | 1 |
| nbflocation not on record | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Clemson, US | 1 |
| ROM007location not on record | 1 |
| Glarus, CH | 1 |
306 institutions · 9 297 of 10 222 vouchered records shown · 886 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA36 detections
Where the DNA of Sanguisorba officinalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found36
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 36 detections have coordinates
Open the map6 countries0
Grassland hillside
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.1 °C 9.50–16.8
Seasonal swing summer↔winter15.1 °C
Max temp (day)17.2 °C 11.8–20.6
Min temp (night)9.90 °C 5.70–13.3
Precipitation86.6 mm/mo 51.4–119
Air humidity62.9 % 57.8–67.5
Moisture balance4.00 mm/mo -30.8–57.2
Vapour deficit596 Pa 425–742
Wind speed3.50 m/s 2.30–4.90
Cloud cover48.0 % 39.4–55.7
CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.