Salvia blepharophylla

Brandegee ex Epling · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Salvia

At a glance

Occurrence records15

Data sources9

Biological traits8

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Salvia blepharophylla's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS20 compounds

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Salvia blepharophylla (eyelash-leaved sage) is a creeping perennial from the Mexican states of San Luis Potosí and Tamaulipas. The epithet, blepharophylla, is from the Greek for "with leaves fringed like eyelashes". It is a rapidly spreading stoloniferous plant with 2.5 cm long signal-red flowers with an orange undertone. The flowers grow in loose whorls spaced about 2.5 cm apart, on 30 cm long inflorescences. In full bloom the plant reaches 45 cm in height.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition20 compounds

Compounds documented for Salvia blepharophylla across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavonols9

Flavones6

Colensane and Clerodane diterpenoids4

Ursane and Taraxastane triterpenoids1

Documented compounds20 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	LOTUS
(1S,3S,4S,7R,8S,9R,10R,14R)-7-(furan-3-yl)-3-hydroxy-9-methyl-6,16-dioxapentacyclo[8.7.0.01,14.04,8.04,9]heptadec-12-ene-5,15-dione	present	LOTUS
(1S,3S,4S,7R,8S,9S,10R,14R)-7-(furan-3-yl)-3-hydroxy-9-methyl-6,16-dioxapentacyclo[8.7.0.01,14.04,8.04,9]heptadec-12-ene-5,15-dione	present	LOTUS
(1S,7R,9S,10R,14R)-7-(furan-3-yl)-9-methyl-6,16-dioxatetracyclo[8.7.0.01,14.04,8]heptadeca-4(8),12-diene-5,15-dione	present	LOTUS
(1S,7S,9R,10S,14R)-7-(furan-3-yl)-9-methyl-6,16-dioxatetracyclo[8.7.0.01,14.04,8]heptadeca-4(8),12-diene-5,15-dione	present	LOTUS
(2S,3S,4R,5S,6S)-6-[2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-4-oxochromen-3-yl]oxy-3,4,5-trihydroxyoxane-2-carboxylic acid	present	LOTUS
2-(3,4-Dihydroxyphenyl)-5,6-dihydroxy-7-methoxy-4H-1-benzopyran-4-one	present	LOTUS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one	present	LOTUS
5,7-dihydroxy-2-(4-hydroxyphenyl)-6-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-8-[(2R,3S,4R,5R)-3,4,5-trihydroxyoxan-2-yl]chromen-4-one	present	LOTUS
5,7-dihydroxy-2-(4-hydroxyphenyl)-8-[(2S,3R,4R,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]chromen-4-one	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Salvia blepharophylla has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSHQ418850.1 ↗618 bp

ACGT

TCGATACCTGCAAAGCAGACTGCGAACACGTGTTTAACACCGGCGGCGTGCGGCGGGGGCGATCCCCGTCCTGCGCTCGTCTCCCCCGCC …

Salvia blepharophylla internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type15 records

Wild obs. + sensor4

Museum / vouchered11

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 3 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 3

5 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Columbia, US	2
Madison, US	2
Mexico City, MX	1
Northridge, US	1
Cambridge, US	1
Los Angeles, US	1
Austin, US	1

7 institutions · 9 of 11 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Salvia blepharophylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)