Saltella sphondylii

(Schrank, 1803) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Sepsidae/Saltella

At a glance

Occurrence records1 467

Data sources7

Biological traits2

DNA specimens882

eDNA detections909

Sources7 archives

Databases and archives Saltella sphondylii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 467 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI909 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics882 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 467 records

Environmental DNA4 datasets · 7 countries909 detections

DNA & barcodingBOLD882 specimens

01Narrative

Saltella sphondylii is a European species of flies and member of the family Sepsidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)saprophagous

Feeding guild (larval)coprophagous

05DNA & barcoding882 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Saltella sphondylii has left across the world's sequence archives.

At a glance

DNA specimens882

BINs1

Marker genes3

eDNA detections909

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus866 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

410Tvariable

413Gvariable

488Cvariable

554Avariable

632Cvariable

CTTTATATTTTATATTTGGAGCATGAGCAGGTATAGTAGGAACATCACTTAGAATTTTAATTCGAGCTGAATTAGGACACCCTGGTGCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes40

BIN1

Most divergent pair1.7%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Microsepsis mitissame family9.5%Opacifrons bisectasame order9.6%Apallates particepssame order9.8%Archisepsis excavatasame family9.8%Sepsis nitenssame family9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type1 467 records

Wild obs. + sensor785

Museum / vouchered674

Cultivated / captive8

Range

Area of Occupancy AOO2 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 360≤1 km 76≤10 km 307>10 km 2

745 georeferenced · 40 without coordinates

Open the mapobservation + sensor785

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 202≤1 km 52≤10 km 100

354 georeferenced · 320 without coordinates

Open the institutions mapphysical evidence674

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	157
University of Guelphlocation not on record	135
WIlocation not on record	60
University of Guelph, Centre for Biodiversity Genomicslocation not on record	43
Tilburg, NL	12
SLU Artdatabankenlocation not on record	11
NCMGlocation not on record	9
DFFW2016location not on record	7
University of Tokyo, Department of Zoologylocation not on record	5
DFFW1981location not on record	2
DFFW2018location not on record	1
CUlocation not on record	1
CBDClocation not on record	1
US	1
San Francisco, US	1
DFlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Toronto, CA	1

18 institutions · 449 of 674 vouchered records shown · 225 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA909 detections

Where the DNA of Saltella sphondylii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found909

Studies independent surveys4

Countries7

Verifiable raw sequence linked24

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 909 detections have coordinates

Open the map7 countries0

WetlandGrassland4. Native GrasslandMixed habitatForest4. Grassland | 4.4. Grassland - Temperate

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 13.0–16.1

Seasonal swing summer↔winter24.7 °C

Max temp (day)19.4 °C 18.5–21.9

Min temp (night)6.10 °C 6.10–13.1

Precipitation32.8 mm/mo 24.1–99.8

Air humidity52.2 % 48.5–63.3

Moisture balance-84.3 mm/mo

Vapour deficit717 Pa 657–874

Wind speed2.30 m/s

Cloud cover45.6 % 31.5–52.9

CHELSA 1981–2010, ~9 km grid, at location & month of 904 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Saltella sphondylii

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 467 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 467 records