Salix ledebouriana

Trautv. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Salicaceae/Salix

At a glance

Occurrence records183

Data sources4

Biological traits8

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Salix ledebouriana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility183 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF183 records

DNA & barcodingNCBIsequences

01Narrative

Ива Ледебура — вид деревянистых растений рода Ива (Salix) семейства Ивовые (Salicaceae). Вид назван в честь немецкого ботаника Карла Фридриха фон Ледебура.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction4

Dispersal typewind

Life formshrub

Life spanperennial

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment3

Aquaticterrestrial

Climatetemperate

Mycorrhiza typePh.th.end.

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Salix ledebouriana has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR678370.1 ↗669 bpKazakhstan · 2023

ACGT

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCCGGCAGAACGACCCGCGAACCCGTGGCATGACAAGCTGGGCTCG …

Salix ledebouriana voucher WK23-ABG000138 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type183 records

Wild obs. + sensor95

Museum / vouchered88

Range

Area of Occupancy AOO604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy19% within 1 km

≤100 m 10≤1 km 6≤10 km 2>10 km 68

86 georeferenced · 9 without coordinates

Open the mapobservation + sensor95

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 27≤10 km 6>10 km 3

36 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence88

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Moscow State Universitylocation not on record	48
Irkutsk State Universitylocation not on record	5
BRNUlocation not on record	4
WTUlocation not on record	2

4 institutions · 59 of 88 vouchered records shown · 29 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)