Salix koriyanagi

Kimura ex Goerz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Salicaceae/Salix

At a glance

Occurrence records749

Data sources9

Biological traits15

DNA specimens3

eDNA detections0

Sources9 archives

Databases and archives Salix koriyanagi's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility749 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources15 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF749 records

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaT · NCBI≈339 Mbp

01Narrative

Salix koriyanagi 'Rubykins' is a species of willow native to Korea. It can reach a height of 4 m before cultivation. Salix koriyanagi is used primarily in Japan for making baskets and furniture.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology8

Inflorescence length max3 cm

Inflorescence length min2 cm

Leaf length75 mm

Leaf length max100 mm

Leaf length min50 mm

Leaf width10.5 mm

Leaf width max15 mm

Leaf width min6 mm

Life cycle & reproduction2

Life formshrub

Life spanperennial

Habitat & environment5

Climatetemperate

Climberself-supporting

Growth formshrub

Habitat GIFTmanaged

Woodinesswoody

03Chemical composition1 compounds

Compounds documented for Salix koriyanagi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Simple phenolic acids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Salireposide		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Salix koriyanagi has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences8

The DNA barcodea real sequence read deposited for this species

rbcLMN206540.1 ↗547 bp

ACGT

GGTGTTGGATTCAAGGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCA …

Salix koriyanagi voucher NSMK-PI20190029 ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL8

animal barcodeplant barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_068760 ↗ · 33 protein · 24 tRNA · 3 rRNA

rps7rps14nad5rps4ccmFCcox1nad2nad4Latp4ccmFNatp8atp6rps12ccmBnad1nad6cox3sdh4rpl10nad7rpl2rps3atp9ccmCrpl16nad9+10

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Salix koriyanagi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈339 126 720 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Salix koriyanagi0.34 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type749 records

Wild obs. + sensor515

Museum / vouchered234

Origin

Introduced1

Range

Area of Occupancy AOO2 164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 512 without coordinates

Open the mapobservation + sensor515

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤1 km 18≤10 km 8

26 georeferenced · 208 without coordinates

Open the institutions mapphysical evidence234

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Korea National Arboretumlocation not on record	29
National Institute of Biological Resourceslocation not on record	19
DMZ botanic gardenlocation not on record	18
KR	17
Beijing, CN	16
Sanda, JP	15
Odawara, JP	14
Herbarium of the Department of Botany, University of Tokyolocation not on record	12
Otaru, JP	12
Tomioka, JP	11
Kochi, JP	10
ifplocation not on record	9
Nagano City, JP	6
JP	5
Tsukuba, JP	5
Kyoto Universitylocation not on record	5
SIHUlocation not on record	5
Parthenon Tama History Museumlocation not on record	5
Osaka, JP	4
Institute of Applied Ecology, Academia Sinicalocation not on record	3
Toyama, JP	2
KOMlocation not on record	2
DNSMlocation not on record	2
Shinshu Universitylocation not on record	2
KIRMlocation not on record	1
Iwate Prefectural Museumlocation not on record	1
Sagamihara, JP	1
Guilin, CN	1
Sendai, JP	1
Kushiro City Museumlocation not on record	1

30 institutions · 234 of 234 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)