Salix fragilis
speciesAt a glance
Occurrence records74 773
Data sources10
Biological traits8
DNA specimens21
eDNA detections18
Sources10 archives
Databases and archives Salix fragilis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility74 773 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics21 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements1 literature sources8 traits
Chemical compositionLOTUS26 compounds
Occurrence & distributionGBIF74 773 records
Environmental DNA1 datasets · 3 countries18 detections
DNA & barcodingBOLD · NCBI21 specimens
Genome at a glanceCCDB · GoaT841 Mbp
01Narrative
Le Saule fragile ou Saule rouge est une espèce de plantes à fleurs de la famille des Salicaceae. C'est un arbre trouvé en Europe et en Asie.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesLEDA
Size & morphology2
Plant height10 m
Seed mass0.117 mg
Life cycle & reproduction3
Dispersal typewind
Life spanperennial
Raunkiær life formphanerophyte
Habitat & environment1
Woodinesswoody
Physiology & chemistry2
Seed longevity index0
Specific leaf area (SLA)9.61 mm²/mg
03Chemical composition26 compounds
Compounds documented for Salix fragilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Simple phenolic acids5
Acyclic monoterpenoids4
Cinnamic acids and derivatives3
Anthocyanidins3
Fatty alcohols3
Documented compounds26 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-[2-(4-hydroxyphenyl)ethoxy]oxane-3,4,5-triol | present | LOTUS | |
| (R)-1-Octen-3-ol | present | LOTUS | |
| 1-Hexanol | present | LOTUS | |
| 3-Octanol | present | LOTUS | |
| 5-Hydroxypipecolic acid | present | LOTUS | |
| [2-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]methyl 1-hydroxy-6-oxocyclohex-2-ene-1-carboxylate | present | LOTUS | |
| Benzyl alcohol | present | LOTUS | |
| Citronellol | present | LOTUS | |
| Cyanidin | present | LOTUS | |
| Delphinidin 3-xyloside 7-rhamnosylglucoside | present | LOTUS |
05DNA & barcoding21 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Salix fragilis has left across the world's sequence archives.
At a glance
DNA specimens21
Marker genes4
GenBank sequences10
eDNA detections18
Countries4
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTCCTGGTCGAGGGCACGTCTGCCTGGGTGTCACGCATC …
Salix fragilis voucher NMW3664 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★ITS5
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Salix fragilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size841 080 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Salix fragilis0.84 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 76 n = 38
Ploidy4× tetraploid · measured
Chromosome records38–1142n range76median76mode17records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 7611×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · brit-fl +6
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · brit-fl — Wilkinson, J. Ann. Bot. (London), n.s. 5: 150-165 (1941)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2224
CCDB · ipcn-api-dl — Krichfalushij, V. V. & L. V. Golyshkin. 1985. Khromosomni chisla predstavnikov rodu Salix L. Ukrajinsk. Bot. Zhurn. SSSR 42(2): 33–34. (In Russian).
CCDB · ipcn-api-dl — Ma, X. h., X. q. Ma & N. Li. 1990. Chromosome observation of some drug plants in Xinjiang. Acta Bot. Boreal.-Occid. Sin. 10: 203–210.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · book-ipcn75-78 — Murin & Vachova 1978
CCDB · book-indian_vol1 — Blackburn, K.B. & Harrison, J.W.H. 1924; Holmberg, O.R. 1931 ; Tiscl1ler, G. 1934; Wilkinson, J. 1944 ; Suda, Y. 1963; Neumann, V.A. & Polatschek, A. 1972
CCDB · book-atlas-flowering-plants — Blackbum & H. 1924 W
CCDB · kew — Thibault J. 1998. Nuclear DNA amount in pure species and hybrid willows (Salix): a flow cytometric investigation. Canadian Journal of Botany-Revue Canadienne De Botanique 76: 157-165.
2n 383×CCDB · slov-fl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · book-ipcn75-78 — Murin & Vachova 1974
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
2n 1143×CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants · CCDB · Cave1963
CCDB · book-indian_vol1 — Marklund Love, A. & Love, D. 1942b)
CCDB · book-atlas-flowering-plants
CCDB · Cave1963 — Suda 1963b
2n 791×CCDB · fl-europaea
CCDB · fl-europaea — Wilkinson, 1941
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type74 773 records
Wild obs. + sensor65 421
Museum / vouchered8 376
Cultivated / captive377
Other599
Origin
Native1 478
Introduced787
Range
Area of Occupancy AOO144 200 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy53% within 1 km
≤100 m 9 303≤1 km 17 839≤10 km 23 397>10 km 657
51 196 georeferenced · 14 225 without coordinates
Open the mapobservation + sensor65 421
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy35% within 1 km
≤100 m 647≤1 km 1 263≤10 km 3 262>10 km 350
5 522 georeferenced · 2 854 without coordinates
Open the institutions mapphysical evidence8 376
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤100 m 23
23 georeferenced · 354 without coordinates
Open the mapnot free-living377
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions138 of 233 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 536 |
| LDlocation not on record | 409 |
| SLU Artdatabankenlocation not on record | 329 |
| MeiseBGlocation not on record | 209 |
| Moscow State Universitylocation not on record | 183 |
| Uppsala, SE | 149 |
| Museo Entomologico de Leonlocation not on record | 145 |
| Oskarshamn, SE | 144 |
| Helsinki, FI | 133 |
| IFR-DNFlocation not on record | 125 |
| St. Paul, US | 121 |
| Christchurch, NZ | 121 |
| Chongqing Museumlocation not on record | 108 |
| Oregon State Universitylocation not on record | 104 |
| Bronx, US | 100 |
| BFLlocation not on record | 98 |
| Tartu, EE | 98 |
| Université Lavallocation not on record | 82 |
| Philadelphia, US | 81 |
| Madison, US | 79 |
| Mount Annan, AU | 76 |
| Olocation not on record | 74 |
| Chicago, US | 74 |
| Montréal, CA | 67 |
| Toronto, CA | 67 |
| MAlocation not on record | 66 |
| Adam Mickiewicz University in Poznańlocation not on record | 62 |
| Uniwersytet Warszawskilocation not on record | 60 |
| Salzburg, AT | 59 |
| Provincia di Livornolocation not on record | 56 |
| Entomological Society of Latvialocation not on record | 51 |
| Görlitz, DE | 50 |
| Allentown, US | 48 |
| South Kensington, GB | 46 |
| València, ES | 45 |
| Tallinn, EE | 42 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 42 |
| Burlington, US | 41 |
| Stockholm, SE | 39 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 39 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 37 |
| Green Bay, US | 32 |
| Philadelphia, US | 31 |
| GZUlocation not on record | 30 |
| Auckland, NZ | 30 |
| Salamanca, ES | 29 |
| Wlocation not on record | 29 |
| Denver, US | 28 |
| BRNUlocation not on record | 26 |
| Bloomington, US | 26 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 24 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 24 |
| Turku, FI | 24 |
| BIO-UNIPIlocation not on record | 22 |
| Berlin, DE | 21 |
| Tula State Universitylocation not on record | 21 |
| Chadron, US | 20 |
| Mlocation not on record | 20 |
| Kew, GB | 20 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 20 |
| KMNlocation not on record | 20 |
| Trondheim, NO | 19 |
| Adelaide, AU | 19 |
| University of Stellenboschlocation not on record | 19 |
| Oswego, US | 18 |
| New Haven, US | 18 |
| Wuzhou, CN | 18 |
| BClocation not on record | 18 |
| Vitoria, ES | 18 |
| Barcelona, ES | 17 |
| Hobart, AU | 16 |
| Karlsruhe, DE | 16 |
| Vancouver, CA | 15 |
| CICYTEXlocation not on record | 15 |
| Staten Island, US | 15 |
| Wellington, NZ | 14 |
| Córdoba, ES | 14 |
| Madrid, ES | 13 |
| Granada, ES | 13 |
| Phyletisches Museum Jenalocation not on record | 12 |
| Museo Achille Folettolocation not on record | 12 |
| College of the Atlantic, Museumlocation not on record | 12 |
| Ivano-Frankove, UA | 11 |
| Beijing, CN | 11 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 11 |
| Ann Arbor, US | 11 |
| Oulu, FI | 11 |
| Saint Louis, US | 11 |
| Jyväskylä, FI | 11 |
| Missoula, US | 11 |
| Corvallis, US | 11 |
| WTUlocation not on record | 10 |
| Dekalb, US | 10 |
| Pocatello, US | 10 |
| Bern, CH | 10 |
| Badajoz, ES | 9 |
| University of Wisconsinlocation not on record | 9 |
| Rotorua, NZ | 9 |
| Pullman, US | 9 |
| Porrentruy, CH | 8 |
| ZRC-SAZUlocation not on record | 8 |
| Caldwell, US | 8 |
| Logan, US | 8 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 8 |
| Saint John, CA | 8 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 8 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 8 |
| Orem, US | 8 |
| NMBU:MINAlocation not on record | 7 |
| Dresden, DE | 7 |
| Flagstaff, US | 7 |
| Boise, US | 7 |
| Spearfish, US | 7 |
| McWane Science Centerlocation not on record | 7 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 6 |
| GJOlocation not on record | 6 |
| Riverside, US | 6 |
| Pamplona, ES | 6 |
| John T. Waterhouse Herbariumlocation not on record | 5 |
| Bergen, NO | 5 |
| Claremont, US | 5 |
| Tampa, US | 5 |
| CJBGlocation not on record | 5 |
| Fulda, DE | 5 |
| Frankfurt am Main | 5 |
| UGentlocation not on record | 5 |
| Canberra, AU | 5 |
| Durango, MX | 5 |
| Williamsburg, US | 5 |
| SZUlocation not on record | 5 |
| US | 4 |
| Whitehorse, CA | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Podgorica, ME | 4 |
| Waverly, US | 4 |
| Acadia Universitylocation not on record | 4 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 4 |
| Brussel, BE | 4 |
| San Isidro, AR | 4 |
| Moscow, US | 4 |
| Armidale, AU | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| Bozeman, US | 4 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 4 |
| Paris, FR | 3 |
| Henderson, US | 3 |
| ifplocation not on record | 3 |
| Sion, CH | 3 |
| Philadelphia, US | 3 |
| Alicante, ES | 3 |
| TUR-Alocation not on record | 3 |
| University of British Columbialocation not on record | 3 |
| Zürich, CH | 3 |
| Mount Pleasant, US | 3 |
| PrivatHerblocation not on record | 3 |
| Bourges, FR | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Viña del Mar, CL | 3 |
| Jaén, ES | 3 |
| Tilburg, NL | 3 |
| John May Museum of Natural Historylocation not on record | 2 |
| Bend, US | 2 |
| Cheney, US | 2 |
| NoColllocation not on record | 2 |
| Victoria, CA | 2 |
| Washington, US | 2 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| nbflocation not on record | 2 |
| Lincoln, US | 2 |
| Provo, US | 2 |
| CASlocation not on record | 2 |
| Gijón, ES | 2 |
| Québec, CA | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Columbia, US | 2 |
| College Park, US | 2 |
| Namur, BE | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Portland, US | 2 |
| Whitewater, US | 2 |
| SNSNMClocation not on record | 2 |
| Durango, US | 2 |
| Palmerston North, NZ | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Musée des Confluenceslocation not on record | 2 |
| WINlocation not on record | 2 |
| Bangkok, TH | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| Xiamen, CN | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| ISAlocation not on record | 1 |
| Albuquerque, US | 1 |
| GAlocation not on record | 1 |
| LfUlocation not on record | 1 |
| Chicago, US | 1 |
| Taipei, TW | 1 |
| Fredericksburg, US | 1 |
| USFS/BHSClocation not on record | 1 |
| San Bernardino, US | 1 |
| Weber State Universitylocation not on record | 1 |
| Hudson, US | 1 |
| Trois-Rivières, CA | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| Millersville, US | 1 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| New Brunswick, US | 1 |
| Cape Town, ZA | 1 |
| Banyoles, ES | 1 |
| Keene State Universitylocation not on record | 1 |
| Clemson, US | 1 |
| Lausanne, CH | 1 |
| BAYLUlocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Monastir, TN | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Davenport, US | 1 |
| Córdoba, AR | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| QVMAGlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 1 |
| Tampere, FI | 1 |
| Minia, EG | 1 |
| Macomb, US | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Angwin, US | 1 |
| ASUlocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| San Luis Obispo, US | 1 |
233 institutions · 7 902 of 8 376 vouchered records shown · 308 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA18 detections
Where the DNA of Salix fragilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found18
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 18 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.8 °C 13.1–18.6
Seasonal swing summer↔winter14.9 °C
Max temp (day)18.8 °C 14.1–23.1
Min temp (night)8.90 °C 8.40–13.8
Precipitation84.6 mm/mo 63.7–98.0
Air humidity58.3 % 54.6–67.9
Moisture balance-30.2 mm/mo -53.1–-8.60
Vapour deficit692 Pa 482–929
Wind speed3.60 m/s 2.50–4.70
Cloud cover43.7 % 34.1–50.6
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.