Salix cinerea
speciesAt a glance
Occurrence records466 244
Data sources15
Biological traits60
DNA specimens42
eDNA detections19
Sources15 archives
Databases and archives Salix cinerea's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility466 244 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics42 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources60 traits
Chemical compositionLOTUS · NPASS21 compounds
Occurrence & distributionGBIF466 244 records
Environmental DNA1 datasets · 5 countries19 detections
DNA & barcodingBOLD · NCBI42 specimens
Genome at a glanceCCDB · GoaT · NCBI841 Mbp
01Narrative
Le Saule cendré ou Saule gris est une espèce de plantes à fleurs de la famille des Salicacées. C'est un arbuste pouvant atteindre 6 mètres de haut. Le Saule cendré est un saule très commun en Europe.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology20
Fruit length9 mm
Leaf length60 mm
⚠ sources differ — AusTraits: 60 mm · GIFT: 70 mm
Leaf length max100 mm
Leaf length min30 mm
Leaf mass153 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 651 mm² · GIFT: 884 mm²
Leaf width30 mm
⚠ sources differ — AusTraits: 30 mm · GIFT: 12.5 mm
Leaf width max40 mm
Leaf width min10 mm
Petiole length0.5 cm
Plant height3.69 m
⚠ sources differ — GIFT: 3.69 m · AusTraits: 10 m · LEDA: 2.75 m · TRY: 4.78 m
Plant height generative2.75 m
Plant height max15 m
Plant height min2 m
Seed length1.22 mm
⚠ sources differ — TRY: 1.22 mm · GIFT: 1.1 mm
Seed length max1.1 mm
Seed length min1.1 mm
Seed mass0.126 mg
⚠ sources differ — TRY: 0.126 mg · LEDA: 0.067 mg · GIFT: 0.034 mg
Seed mass max0 mg
Seed mass min0 mg
Life cycle & reproduction16
Deciduousnessdeciduous
Dehiscencedehiscent
Dispersal typewind
Flowering endApr
Flowering startMar
Life formtree
Life spanperennial
Lifespan years11 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formphanerophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Seed number7 434 009
Self fertilizationabsent
Sex typedioecious
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typecapsule
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: shrub tree · TRY: shrub
Habitat GIFTcanals, forest, swamps
Leaf compoundnesssimple
Leaf shapeelliptical obtriangular widely_obovate
Mycorrhiza typeectomycorrhizal
Woodinesswoody
Physiology & chemistry10
Leaf C:N ratio21.59 g/g
Leaf c489 mg/g
Leaf dry-matter content (LDMC)369 mg/g
⚠ sources differ — TRY: 369 mg/g · LEDA: 439 mg/g
Leaf n22.31 mg/g
Leaf p1.6 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)10.52 mm²/mg
Wood density453 mg/cm³
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition21 compounds
Compounds documented for Salix cinerea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Simple phenolic acids5
Anthocyanidins3
Phenylethanoids2
Cinnamic acids and derivatives2
Aminoacids1
Documented compounds21 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-2-Carene | present | NPASS | |
| (-)-Borneol | present | NPASS | |
| (2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-[2-(4-hydroxyphenyl)ethoxy]oxane-3,4,5-triol | present | LOTUS | |
| 5-Hydroxypipecolic acid | present | LOTUS | |
| [2-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]methyl 1-hydroxy-6-oxocyclohex-2-ene-1-carboxylate | present | LOTUS | |
| Cyanidin | present | LOTUS | |
| Delphinidin 3-xyloside 7-rhamnosylglucoside | present | LOTUS | |
| Fragilin | present | LOTUS | |
| Grandidentatin | present | LOTUS | |
| Picein | present | LOTUS |
05DNA & barcoding42 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Salix cinerea has left across the world's sequence archives.
At a glance
DNA specimens42
Marker genes6
GenBank sequences10
eDNA detections19
Countries8
The DNA barcodea real sequence read deposited for this species
GCGAACCCGTGGCATGACAAGCTGGGCTCGGGGGGCACCCGCCCCTCGTGTCCACGCGTGCCGTGGAGGGACGCATCTGCGCCCGACACG …
Salix cinerea voucher KS23 HER0275 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL2★rbcLa★ITS5★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Salix cinerea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size841 080 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Salix cinerea0.84 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 76 n = 38
Ploidy4× tetraploid · measured
Chromosome records44–762n range76median76mode28records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 7626×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +9
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · brit-fl — Harrison, J.W.H. J. Exp. Biol. 1: 445-472 (1924)
CCDB · brit-fl — Blackburn, K.B., Heslop Harrison, J.W. Ann. Bot. (London) 38: 361-378 (1924)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2248
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2249
CCDB · fl-europaea — Blackburn & Heslop
CCDB · ipcn-api-dl — Krichfalushij, V. V. & L. V. Golyshkin. 1985. Khromosomni chisla predstavnikov rodu Salix L. Ukrajinsk. Bot. Zhurn. SSSR 42(2): 33–34. (In Russian).
CCDB · ipcn-api-dl — Druskovic, B. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 11–14.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · eflora
CCDB · book-fedorov — Blackburn, Harrison 1924
CCDB · book-fedorov — Harrison J. W. 1926
CCDB · book-fedorov — Holmberg 1931
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Wilkinson 1944
CCDB · book-fedorov — Cl>eAOPOBa-CapKHCOBa 1946
CCDB · book-atlas-flowering-plants — Harrison 1926
CCDB · kew — Thibault J. 1998. Nuclear DNA amount in pure species and hybrid willows (Salix): a flow cytometric investigation. Canadian Journal of Botany-Revue Canadienne De Botanique 76: 157-165.
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — Druskovic, B. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 11-14.
CCDB · CromoCat 2015 — Hörandl, E. (1991). Die Gattung Salix in österreich (mit Berücksichtigung angrenzender Gebiete). Diss. Universität Wien. pp. 185.
CCDB · CromoCat 2015 — Hörandl, E. (1992). Die Gattung Salix in österreich (mit Berücksichtigung angrenzender Gebiete). Abh. Zool.-Bot. Ges. Österreich 27:1-170.
CCDB · CromoCat 2015 — Krichfalushij, V. V. & Golyshkin, L. V. (1985). Khromosomni chisla predstavnikov rodu Salix L. Ukrajinsk. Botaniceskjij Žurnal SSSR 42(2): 33-34. (In Russian).
CCDB · CromoCat 2015 — Neumann, A. & A. Polatschek. (1972). Cytotaxonomischer Beitrag zur gattung Salix. Ann. Naturhist. Mus. Wien 76: 619-633.
2n 442×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Zakirova, R. O. 1999. Chromosome numbers of some Alliaceae, Salicaceae, Polygonaceae, and Chenopodiaceae of the South Balkhash territory. Citologija 41(12): 1064.
CCDB · CromoCat 2015 — Zakirova, R. O. (1999). Chromosome numbers of some Alliaceae, Salicaceae, Polygonaceae, and Chenopodiaceae of the South Balkhash territory Citologija 41(12): 1064
n 383×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Büchler, W. 1986. Neue Chromosomenzählungen in der Gattung Salix. 2. Teil. Bot. Helv. 96: 135–143.
CCDB · CromoCat 2015 — Büchler, W. (1986). Neue chromosomenzählungen in der gattung Salix. 2 Teil. Bot. Helv. 96: 135-143.
CCDB · CromoCat 2015 — Neumann, A. & A. Polatschek. (1972). Cytotaxonomischer Beitrag zur gattung Salix. Ann. Naturhist. Mus. Wien 76: 619-633.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98.4% BUSCO
08Occurrence & distribution
Record type466 244 records
Wild obs. + sensor450 370
Museum / vouchered14 571
Cultivated / captive383
Fossil22
Other898
Origin
Native25 180
Introduced2 846
Range
Area of Occupancy AOO429 420 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy55% within 1 km
≤100 m 121 178≤1 km 78 751≤10 km 164 530>10 km 1 804
366 263 georeferenced · 84 107 without coordinates
Open the mapobservation + sensor450 370
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 1 252≤1 km 3 106≤10 km 4 944>10 km 1 069
10 371 georeferenced · 4 200 without coordinates
Open the institutions mapphysical evidence14 571
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy5% within 1 km
≤100 m 1≤10 km 1>10 km 17
19 georeferenced · 364 without coordinates
Open the mapnot free-living383
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions87 of 171 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 5 312 |
| Moscow State Universitylocation not on record | 927 |
| LDlocation not on record | 669 |
| Helsinki, FI | 640 |
| DBF-NHMDlocation not on record | 538 |
| Olocation not on record | 367 |
| Uppsala, SE | 354 |
| BFLlocation not on record | 235 |
| Tartu, EE | 226 |
| MeiseBGlocation not on record | 189 |
| Adam Mickiewicz University in Poznańlocation not on record | 183 |
| IFR-DNFlocation not on record | 172 |
| Museo Entomologico de Leonlocation not on record | 169 |
| Oskarshamn, SE | 161 |
| Christchurch, NZ | 156 |
| Oulu, FI | 156 |
| Salzburg, AT | 145 |
| Görlitz, DE | 141 |
| Lausanne, CH | 139 |
| BIO-UNIPIlocation not on record | 132 |
| SLU Artdatabankenlocation not on record | 122 |
| Tallinn, EE | 110 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 93 |
| Mlocation not on record | 79 |
| Provincia di Livornolocation not on record | 78 |
| Karlsruhe, DE | 74 |
| Turku, FI | 74 |
| Podgorica, ME | 72 |
| Uniwersytet Warszawskilocation not on record | 64 |
| Hobart, AU | 58 |
| Bern, CH | 57 |
| Wlocation not on record | 53 |
| Trondheim, NO | 52 |
| Urumqi, CN | 51 |
| Mount Annan, AU | 50 |
| KMNlocation not on record | 49 |
| BRNUlocation not on record | 49 |
| Auckland, NZ | 44 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 43 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 37 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 34 |
| South Kensington, GB | 33 |
| Jyväskylä, FI | 32 |
| Kuopio, FI | 31 |
| CJBGlocation not on record | 30 |
| GJOlocation not on record | 29 |
| Bronx, US | 25 |
| Zürich, CH | 25 |
| GZUlocation not on record | 24 |
| Dresden, DE | 24 |
| Berlin, DE | 23 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 21 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 20 |
| Stockholm, SE | 20 |
| Adelaide, AU | 20 |
| Zürich, CH | 20 |
| Beijing, CN | 19 |
| Bergen, NO | 18 |
| UGentlocation not on record | 17 |
| Rotorua, NZ | 17 |
| Tula State Universitylocation not on record | 15 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 15 |
| Porvoo, FI | 14 |
| Canberra, AU | 14 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 14 |
| Porrentruy, CH | 13 |
| SZUlocation not on record | 13 |
| PrivatHerblocation not on record | 12 |
| Philadelphia, US | 12 |
| ZRC-SAZUlocation not on record | 11 |
| Glarus, CH | 11 |
| Uniwersytet Śląski w Katowicachlocation not on record | 11 |
| Yangling, CN | 11 |
| NMBU:MINAlocation not on record | 11 |
| University of Stellenboschlocation not on record | 11 |
| Frauenfeld, CH | 10 |
| Frankfurt am Main | 10 |
| Sion, CH | 9 |
| Natural History Museum Rotterdamlocation not on record | 9 |
| Allentown, US | 8 |
| TROMlocation not on record | 7 |
| Brisbane, AU | 7 |
| Wellington, NZ | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Chicago, US | 5 |
| Winterthur, CH | 5 |
| John May Museum of Natural Historylocation not on record | 5 |
| PRClocation not on record | 5 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 5 |
| TUR-Alocation not on record | 4 |
| National Museum Waleslocation not on record | 4 |
| Bourges, FR | 4 |
| WTUlocation not on record | 4 |
| College Park, US | 4 |
| Forssa, FI | 4 |
| Parkville, AU | 4 |
| Kew, GB | 4 |
| Dekalb, US | 4 |
| SNSNMClocation not on record | 4 |
| Samara National Research Universitylocation not on record | 4 |
| Xiamen, CN | 4 |
| MAlocation not on record | 4 |
| BDBClocation not on record | 4 |
| Tilburg, NL | 3 |
| NTNU University Museum, Department of Natural Historylocation not on record | 3 |
| Kensington, AU | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| BClocation not on record | 3 |
| Fulda, DE | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| Madison, US | 3 |
| Morgantown, US | 3 |
| Ann Arbor, US | 3 |
| Taipei, TW | 3 |
| Barcelona, ES | 3 |
| Vancouver, CA | 3 |
| Brussel, BE | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Tromso University Museumlocation not on record | 2 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 2 |
| Bangkok, TH | 2 |
| NMWlocation not on record | 2 |
| Nanjing, CN | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| BGBMlocation not on record | 2 |
| Logan, US | 2 |
| Armidale, AU | 2 |
| Servico de Microbiologia e Imunologialocation not on record | 2 |
| Wuzhou, CN | 2 |
| BSBIlocation not on record | 2 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 2 |
| Granada, ES | 2 |
| Lanzhou, CN | 2 |
| Saint Louis, US | 2 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 2 |
| Corvallis, US | 1 |
| New Haven, US | 1 |
| Sevilla, ES | 1 |
| ifplocation not on record | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| Philadelphia, US | 1 |
| Acadia Universitylocation not on record | 1 |
| CEPLAClocation not on record | 1 |
| FLADlocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| University of Birminghamlocation not on record | 1 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 1 |
| Pamplona, ES | 1 |
| Monastir, TN | 1 |
| Toronto, CA | 1 |
| nbflocation not on record | 1 |
| Salamanca, ES | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| Santa Barbara, US | 1 |
| McWane Science Centerlocation not on record | 1 |
| Namur, BE | 1 |
| Philadelphia, US | 1 |
| Rovaniemi, FI | 1 |
| Sant Julià de Lòria, AD | 1 |
| Chongqing Museumlocation not on record | 1 |
| Chapel Hill, US | 1 |
| Tulane Universitylocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| Durham, US | 1 |
| Siberian Federal Universitylocation not on record | 1 |
| Fribourg, CH | 1 |
| Museum of the Rockieslocation not on record | 1 |
| QVMAGlocation not on record | 1 |
| NoColllocation not on record | 1 |
171 institutions · 13 260 of 14 571 vouchered records shown · 1 135 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA19 detections
Where the DNA of Salix cinerea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map5 countries0
in very wet habitat with tall sedges and gra…old fields S of Marcy farm, disturbed edge o…Et par ca 3 m høye busker
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.9 °C 11.0–16.1
Seasonal swing summer↔winter15.9 °C
Max temp (day)17.0 °C 14.4–18.8
Min temp (night)9.60 °C 6.40–13.9
Precipitation90.5 mm/mo 60.8–116
Air humidity61.3 % 55.4–65.0
Moisture balance-27.9 mm/mo
Vapour deficit609 Pa 503–726
Wind speed4.00 m/s
Cloud cover48.2 % 41.8–51.0
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.