Russula nobilis

Velen. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Russulales/Russulaceae/Russula

At a glance

Occurrence records8 310

Data sources10

Biological traits0

DNA specimens3

eDNA detections1 361

Sources10 archives

Databases and archives Russula nobilis's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 310 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 361 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF8 310 records

Environmental DNA5 datasets · 16 countries1 361 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Formerly Russula mairei (Singer), and commonly known as the beechwood sickener, the now re-classified fungus Russula nobilis (Velen.) is a basidiomycete mushroom of the genus Russula. This group of mushrooms are noted for their brittle gills and bright colours.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition4 compounds

Compounds documented for Russula nobilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Lactarane sesquiterpenoids3

Protoilludane sesquiterpenoids1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
2-Hydroxy-8-methoxy-5,5,8-trimethyl-12,14-dioxatetracyclo[8.4.0.01,13.03,7]tetradecan-11-one	present	LOTUS
Russulanobiline A	present	LOTUS
Russulanobiline B	present	LOTUS
Russulanobiline C	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Russula nobilis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences4

eDNA detections1 361

Countries16

The DNA barcodea real sequence read deposited for this species

ITSPV706727.1 ↗630 bpChina · 2022

ACGT

TTATCGTAAAACCGAGGTGCGGAGGGCTGTCGCTGACCTTTTGGTTGTGCACGCCCAAAGTGCTCTCACACAATCCATCTCACCCCTTTG …

Russula nobilis voucher HKAS 134283 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type8 310 records

Wild obs. + sensor8 083

Museum / vouchered203

Other24

Range

Area of Occupancy AOO11 196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 1 324≤1 km 2 115≤10 km 4 542>10 km 11

7 992 georeferenced · 91 without coordinates

Open the mapobservation + sensor8 083

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 9≤1 km 17≤10 km 19

45 georeferenced · 158 without coordinates

Open the institutions mapphysical evidence203

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WU-MYClocation not on record	32
BDBClocation not on record	19
Vitoria, ES	17
SLU Artdatabankenlocation not on record	9
Kew, GB	8
Bardejov, SK	6
Karlsruhe, DE	6
Salzburg, AT	5
Uniwersytet Łódzkilocation not on record	5
MAlocation not on record	2
University of Oslo, Natural History Museumlocation not on record	1
Royal Botanic Gardens, Kewlocation not on record	1
San Sebastián, ES	1
Olocation not on record	1
Universidade de Lisboa, Museu Bocagelocation not on record	1

15 institutions · 114 of 203 vouchered records shown · 89 without an institution code

09Environmental DNA1 361 detections

Where the DNA of Russula nobilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 361

Studies independent surveys5

Countries16

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 361 detections have coordinates

Open the map16 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median2.40 °C 1.80–13.9

Seasonal swing summer↔winter16.4 °C

Max temp (day)3.80 °C 3.40–15.8

Min temp (night)0.9 °C -1.90–9.20

Precipitation58.3 mm/mo 58.3–296

Air humidity69.2 % 55.1–69.2

Moisture balance32.2 mm/mo -2.10–220

Vapour deficit226 Pa 217–607

Wind speed5.10 m/s 2.60–5.10

Cloud cover59.2 % 30.4–59.2

CHELSA 1981–2010, ~9 km grid, at location & month of 1 327 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Russula nobilis

At a glance

Sources10 archives

Compound class profile2 classes

Documented compounds4 total

At a glance

Record type8 310 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 310 records