Russula amethystina

Quél. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Russulales/Russulaceae/Russula

At a glance

Occurrence records940

Data sources9

Biological traits0

DNA specimens9

eDNA detections1 441

Sources9 archives

Databases and archives Russula amethystina's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility940 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 441 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF940 records

Environmental DNA4 datasets · 17 countries1 441 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Russula amethystina is a conspicuous mushroom, which appears sporadically from mid-summer until the autumn under spruce and fir trees. In Northern Europe, it is very rare. It is not easy to distinguish from similarly coloured Russula species, and practically identical to Russula turci.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Russula amethystina has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes1

GenBank sequences10

eDNA detections1 441

Countries17

The DNA barcodea real sequence read deposited for this species

ITSPV471103.1 ↗404 bpChina · 2023

ACGT

CATTATCATACAACGGGGGTGCGAGGGCTGTCGCTGACCTTTCAAAAGGTCGTGCACGCCTGAGCACTCTCACACATCCATTTCACCCCT …

Russula amethystina voucher HKAS134387 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type940 records

Wild obs. + sensor769

Museum / vouchered162

Other9

Range

Area of Occupancy AOO2 408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 54≤1 km 30≤10 km 439>10 km 63

586 georeferenced · 183 without coordinates

Open the mapobservation + sensor769

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 17≤1 km 33≤10 km 42>10 km 5

97 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence162

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WU-MYClocation not on record	26
Olocation not on record	16
BDBClocation not on record	12
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	12
Helsinki, FI	8
Philadelphia, US	8
University of Oslo, Natural History Museumlocation not on record	6
GJOlocation not on record	4
Salzburg, AT	3
Karlsruhe, DE	3
Oulu, FI	3
Kuopio, FI	3
Bronx, US	2
Turku, FI	2
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	2
Umeå Universitylocation not on record	2
Universidade de Lisboa, Museu Bocagelocation not on record	2
nsnflocation not on record	2
Córdoba, ES	2
Görlitz, DE	1
TENN-Flocation not on record	1
Salamanca, ES	1
MeiseBGlocation not on record	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
Bardejov, SK	1
Cercle des Mycologues de Montreal Fungariumlocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
CJBGlocation not on record	1
Göteborg, SE	1
TUR-Alocation not on record	1
Blacksburg, US	1

31 institutions · 130 of 162 vouchered records shown · 32 without an institution code

09Environmental DNA1 441 detections

Where the DNA of Russula amethystina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 441

Studies independent surveys4

Countries17

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 441 detections have coordinates

Open the map17 countries0

PalearcticEarlier grazed decideousOligotrophic pine forest, boreonemoral zone,…Probably under Quercus, but also Pinus

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.5 °C 5.80–17.6

Seasonal swing summer↔winter22.2 °C

Max temp (day)15.6 °C 9.20–21.8

Min temp (night)7.90 °C -0.1–13.8

Precipitation78.3 mm/mo 56.6–225

Air humidity61.8 % 58.9–64.4

Moisture balance1.90 mm/mo -49.5–104

Vapour deficit569 Pa 339–808

Wind speed3.30 m/s 2.10–5.70

Cloud cover39.6 % 30.4–48.3

CHELSA 1981–2010, ~9 km grid, at location & month of 1 354 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)