Rumex acetosella
speciesAt a glance
Occurrence records590 402
Data sources15
Biological traits81
DNA specimens71
eDNA detections36
Sources15 archives
Databases and archives Rumex acetosella's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility590 396 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics71 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources81 traits
Chemical compositionLOTUS4 compounds
Occurrence & distributionGBIF · PBDB590 402 records
Environmental DNA1 datasets · 9 countries36 detections
DNA & barcodingBOLD · NCBI71 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex2.4 Gbp
Deep timePBDB6 fossils
01Narrative
Rumex acetosella, la Petite Oseille, ou Vinette en français acadien et en poitevin, est une espèce de plantes herbacée de la famille des Polygonacées. Elle pousse dans les endroits rocailleux, en terrain acide. C'est une plante comestible. Dans de nombreuses cultures, c'est une adventice difficile à combattre à cause de sa racine profonde et de sa propagation par rhizome superficiel. Un cas de résistance à un herbicide, l'hexazinone, a été signalé en Nouvelle-Écosse en 2014.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology28
Fruit length1.25 mm
⚠ sources differ — AusTraits: 1.25 mm · GIFT: 1.42 mm
Fruit length max1.5 mm
Fruit length min1 mm
Fruit width1 mm
Fruit width max1 mm
Leaf length20 mm
⚠ sources differ — AusTraits: 20 mm · GIFT: 30 mm
Leaf length max70 mm
Leaf length min10 mm
Leaf mass1.95 mg
⚠ sources differ — AusTraits: 1.95 mg · LEDA: 6.19 mg
Leaf mass per area70.85 g/m2
Leaf size283 mm²
⚠ sources differ — TRY: 283 mm² · AusTraits: 427 mm² · LEDA: 116 mm² · GIFT: 205 mm²
Leaf width10 mm
⚠ sources differ — AusTraits: 10 mm · GIFT: 6.5 mm
Leaf width max30 mm
Leaf width min2 mm
Petiole length1 cm
Plant height0.155 m
⚠ sources differ — GIFT: 0.155 m · AusTraits: 0.5 m · LEDA: 0.15 m · TRY: 0.19 m
Plant height generative0.225 m
Plant height max0.6 m
Plant height min0.05 m
Seed length1.56 mm
Seed length max1.6 mm
Seed length min1.6 mm
Seed mass0.424 mg
⚠ sources differ — TRY: 0.424 mg · AusTraits: 0.473 mg · LEDA: 0.364 mg · GIFT: 0.541 mg
Seed mass max4 mg
Seed mass min0.1 mg
Seed volume0.34 mm³
Seed volume max0.34 mm³
Seed volume min0.34 mm³
Life cycle & reproduction21
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeundefined
⚠ sources differ — AusTraits: undefined · LEDA: endozoochor · GIFT: anemochorous
Flower colourgreen
Flower length max0.7 mm
Flower length min0.5 mm
Flowering endJul
Flowering startMay
Flowering timennnnnnnnyyyy
Life formperennial
Life spanperennial
Lifespan years4 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formcryptophyte
⚠ sources differ — LEDA: Geophyte · GIFT: hemicryptophyte
Reproduction asexualabsent
Reproductive maturity1 years
Resprouting capacityfire_killed
Seed number1 000
Self fertilizationpresent
Sex typedioecious
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 900 m
Elevation mean1 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typenut
⚠ sources differ — AusTraits: nut · GIFT: achene
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf shapelinear narrowly_ovate obovate
Mycorrhiza typeAMNM
Woodinessnon-woody
Physiology & chemistry10
Leaf C:N ratio13.57 g/g
Leaf c445 mg/g
Leaf dry-matter content (LDMC)137 mg/g
⚠ sources differ — TRY: 137 mg/g · LEDA: 108 mg/g
Leaf n24.41 mg/g
Leaf p2.34 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)20.23 mm²/mg
⚠ sources differ — TRY: 20.23 mm²/mg · LEDA: 24.8 mm²/mg · GIFT: 24.09 mm²/mg
Wood density138 mg/cm³
Other traits5
Diaspore typegenerative dispersule
Inflorescenceraceme
Leaf arrangementalternate
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition4 compounds
Compounds documented for Rumex acetosella across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Anthraquinones and anthrones2
Flavones2
Documented compounds4 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Citreorosein | present | LOTUS | |
| Emodin | present | LOTUS | |
| Luteolin 7-diglucoside | present | LOTUS | |
| Luteolin 7-glucoside | present | LOTUS |
05DNA & barcoding71 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rumex acetosella has left across the world's sequence archives.
At a glance
DNA specimens71
Marker genes9
GenBank sequences10
eDNA detections36
Countries10
The DNA barcodea real sequence read deposited for this species
ACCGCGTCGCCCCCCCTCCCCCCTTCGGGCGGGGATCGGGGGCGGAGAATGGCCTCCCGTGCGCCTCGGCGCGCGGCCGGCCTAAACGCA …
Rumex acetosella isolate CL2021-2024 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL2★rbcLa★trnL-F★ITS6★ITS1★ITS2atpF-atpHtrnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Rumex acetosella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 435 220 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Rumex acetosella2.44 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Ploidy2× diploid · measured
Chromosome records14–562n range33median42mode122records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4256×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +15
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · iapt — IAPT/IOPB Chromosome Data 14
CCDB · brit-fl — Harris, W. New Zealand J. Bot. 7: 125-141 (1969)
CCDB · fl-europaea — Lttve, 1940
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1989. Chromosome numbers in vascular plants from Primorye Territory, the Amur region, Sakhalin, Kamchatka and the Kuril Islands. Bot. Žhurn. (Moscow & Leningrad) 74: 120–123.
CCDB · ipcn-api-dl — Queiros, M. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 598.
CCDB · ipcn-api-dl — DEGRAEVE, N. 1980. Contribution a l'etude cytotaxonomique des Rumex III. Le genre Acetosella Fourr. Genetica 54: 29–34.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.
CCDB · ipcn-api-dl — Borgen, L. & R. Elven. 1983. Chromosome numbers of flowering plants from northern Norway and Svalbard. Nord. J. Bot. 3: 301–306.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapov. Belorussii Issl. 10: 24–28.
CCDB · ipcn-api-dl — Nijs, J. C. M. D., H. Hooghiemstra & P. H. Schalk. 1980. Biosystematic studies of the Rumex acetosella complex (Polygonaceae). IV. Pollen morphology and the possibilities of identification of cytotypes in pollen analysis. Phyton (Horn) 20: 307–323.
CCDB · ipcn-api-dl — Albers, F. & A. Hein. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Huber, W. & M. Baltisberger. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 19–20.
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & A. P. Sokolovskaya. 1996. Chromosome numbers in synanthropic plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 81(5): 98–101.
CCDB · book-ipcn72 — SINGH, R.B. 1972. Karyotype changes in intersubgeneric hybrids of Rumex. Cytologia 37: 377-381.
CCDB · book-ipcn67-71 — KAPOOR, B.M. & A. LOV~. 1969. In IOPB chromosome number reports xx. Taxon 18: 213-221.
CCDB · book-ipcn67-71 — KAPOOR, B.M. 1970. In IOPB chromosome number reports XXVII. Taxon 19: 437-442.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — SINGH, R.B. 1971. Repatterning of the karyotype in a polyploid dioecious Rumex. Cytologia 36: 405-410.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — SINGH, R.B. 1968. Meiotic chromosome behaviour and structural hybridity in a polyploid dioecious Rumex. Nucleus, Suppl. vol. 1968: 362-371.~~-
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-northern-plants — A. Love 1941, 1943.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. III Dicotyledons: Salicaceae - Rosaceae. Lagascalia 4: 3-32.
CCDB · book-fedorov — Kihara 1927a,b
CCDB · book-fedorov — Ono T. 1930b, 1935
CCDB · book-fedorov — Tischler 1934 1ensen 1936b
CCDB · book-fedorov — Rohweder 1937
CCDB · book-fedorov — Love A. 1941b, 1944b
CCDB · book-fedorov — Heiser, Whitaker 1948
CCDB · book-fedorov — Jor~ensen et al. 1958
CCDB · book-fedorov — Mu ligan 1959
CCDB · book-fedorov — Sorsa V. 1962
CCDB · book-fedorov — Gadella, Kliphuis 1966
CCDB · kew — Bennett MD, Smith JB, Lewis Smith RI. 1982. DNA amounts of angiosperms from the Antarctic and South Georgia. Environmental and Experimental Botany 22: 307-318.
CCDB · Cave1958 — Jorgensen et al. 1958
+14 more references
2n 2834×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · slov-fl +9
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — LOEVE A. - 1983. IOPB chromosome number reports LXXX.. Taxon , 32(2): 511.
CCDB · ita-fl — DEN NIJS J.C.M. - 1976. Biosystematic studies of the Rumex acetosella-complex II. The alpine region.. Acta Bot. Neerl. , 25(6): 417-447.
CCDB · slov-fl — Den Nijs J. C. M. & van der Hulst A. W., 1982: Biosystematic studies of the Rumex acetosella complex V. Cytogeography and morphology in the Czech Socialistic Republic and a part of Lower Austria (Austria). - Folia Geobot. Phytotax. 17/1: 49-62.
CCDB · brit-fl — Richards, A.J. (18.x.1971)
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · ipcn-api-dl — Love, A. 1983. In: IOPB chromosome number reports LXXX. Taxon 32: 511.
CCDB · ipcn-api-dl — Probatova. 2006. Chromosome numbers of plants of the Primorsky Territory, the Amur River basin and Magadan region. Bot. Žhurn. (Moscow & Leningrad) 91(3): 491–509.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1983. Chromosome numbers in flowering plants from Greece. Willdenowia 13: 329–333.
CCDB · ipcn-api-dl — Franzen, R. & L. A. Gustavsson. 1983. Chromosome numbers in flowering plants from the high mountains of Sterea Ellas, Greece. Willdenowia 13: 101–106.
CCDB · ipcn-api-dl — DEGRAEVE, N. 1980. Contribution a l'etude cytotaxonomique des Rumex III. Le genre Acetosella Fourr. Genetica 54: 29–34.
CCDB · ipcn-api-dl — Stoeva, M. P. 1987. Chromosome numbers of Bulgarian angiosperms. Fitologija 33: 65–66.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · book-ipcn67-71 — STERK, A.A. 1970. Rumex anqiocarpus in south Africa. Acta Bot. Neerl. 19: 285-286.
CCDB · book-ipcn75-78 — 42
CCDB · book-fedorov — Mattick (I. 1950)
CCDB · CromoCat 2015 — Den Nijs, J. C. M. & van der Hulst, A. W. (1982). Biosystematic studies of the Rumex acetosella complex V. Cytogeography and morphology in the Czech Socialistic Republic and a part of lower Austria. Folia Geobot. Phytotax. (Czech.) 17: 49-62
CCDB · CromoCat 2015 — Den Nijs, J. C. M. (1983). Biosystematic studies of the Rumex acetosella complex. Thesis. Amsterdam. 1-157
CCDB · CromoCat 2015 — Franzén, R. & Gustavsson, L. A. (1983). Chromosome numbers in flowering plants from the high mountains of Sterea Ellas, Greece. Willdenowia 13: 101-106.
CCDB · CromoCat 2015 — Löve, A. (1983b). The taxonomy of Acetosella. Bot. Helv. 93(2):145-168.
CCDB · CromoCat 2015 — Nijs, J. (1976). Biosystematic studies of the Rumex acetosella-complex II. The Alpine region. Acta Bot. Neerl. 25(6):417-447
CCDB · CromoCat 2015 — Nijs, J. (1983). Biosystematic studies of the Rumex acetosella complex (Polygonaceae). VI. Bot. Jahrb. Syst. 104: 33-90.
CCDB · CromoCat 2015 — Nijs, J., H. Hooghiemstra & P. Shalk. (1980). Biosystematic studies of the Rumex acetosella complex. Phyton (Horn) 20: 307-323.
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1983b). Chromosome numbers in flowering plants from Greece. Willdenowia 13: 329-333.
CCDB · CromoCat 2015 — Tischler, G. (1950). Die chromosomenzhalen der GefäBpflanzen Mitteleuropas. s'-Gravenhage: W. Junk. 263
CCDB · CromoCat 2015 — Stoeva, M. P. (1987a). Chromosome numbers of Bulgarian Angiosperms. Fitologija 33: 65-66.
CCDB · iapt — IAPT/IOPB Chromosome Data 26
CCDB · Automatic manuscript search — N. Degraeve. 1980. "Contribution a l'etude cytotaxonomique des rumex III. Le genre acetosella fourr". Genetica 54:29-34.
2n 1424×GoaT · Tree of Sex Database · CCDB · ita-fl · CCDB · fl-europaea +7
GoaT · Tree of Sex Database — ↗
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · ita-fl — DEN NIJS J.C.M. - 1976. Biosystematic studies of the Rumex acetosella-complex II. The alpine region.. Acta Bot. Neerl. , 25(6): 417-447.
CCDB · fl-europaea — Lttve, 1941
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — DEGRAEVE, N. 1980. Contribution a l'etude cytotaxonomique des Rumex III. Le genre Acetosella Fourr. Genetica 54: 29–34.
CCDB · ipcn-api-dl — Huber, W. & M. Baltisberger. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 19–20.
CCDB · ipcn-api-dl — Stoeva, M. P. 1985. Chromosome numbers of Bulgarian angiosperms. Fitologija 30: 78–79.
CCDB · book-ipcn66 — Pazourkova 1966
CCDB · book-ipcn67-71 — SINGH, R.B. 1971. Repatterning of the karyotype in a polyploid dioecious Rumex. Cytologia 36: 405-410.
CCDB · book-ipcn75-78 — 21-23
CCDB · CromoCat 2015 — Den Nijs, J. C. M. & van der Hulst, A. W. (1982). Biosystematic studies of the Rumex acetosella complex V. Cytogeography and morphology in the Czech Socialistic Republic and a part of lower Austria. Folia Geobot. Phytotax. (Czech.) 17: 49-62
CCDB · CromoCat 2015 — Den Nijs, J. C. M. (1983). Biosystematic studies of the Rumex acetosella complex. Thesis. Amsterdam. 1-157
CCDB · CromoCat 2015 — Huber, W. & Baltisberger, M. (1989). IOPB Chromosome Data 1 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 13: 19-20.
CCDB · CromoCat 2015 — Löve, A. (1983b). The taxonomy of Acetosella. Bot. Helv. 93(2):145-168.
CCDB · CromoCat 2015 — Nijs, J. (1976). Biosystematic studies of the Rumex acetosella-complex II. The Alpine region. Acta Bot. Neerl. 25(6):417-447
CCDB · CromoCat 2015 — Nijs, J. (1983). Biosystematic studies of the Rumex acetosella complex (Polygonaceae). VI. Bot. Jahrb. Syst. 104: 33-90.
CCDB · CromoCat 2015 — Stoeva, M. P. (1985). Chromosome numbers of Bulgarian angiosperms. Fitologija (Sofia) 30: 78-79.
CCDB · Automatic manuscript search — N. Degraeve. 1980. "Contribution a l'etude cytotaxonomique des rumex III. Le genre acetosella fourr". Genetica 54:29-34.
TreeOfSex · plant — Goldblatt1979 ↗
2n 353×CCDB · ita-fl · CCDB · CromoCat 2015
CCDB · ita-fl — DEN NIJS J.C.M. - 1976. Biosystematic studies of the Rumex acetosella-complex II. The alpine region.. Acta Bot. Neerl. , 25(6): 417-447.
CCDB · CromoCat 2015 — Den Nijs, J. C. M. & van der Hulst, A. W. (1982). Biosystematic studies of the Rumex acetosella complex V. Cytogeography and morphology in the Czech Socialistic Republic and a part of lower Austria. Folia Geobot. Phytotax. (Czech.) 17: 49-62
CCDB · CromoCat 2015 — Nijs, J. (1976). Biosystematic studies of the Rumex acetosella-complex II. The Alpine region. Acta Bot. Neerl. 25(6):417-447
2n 212×CCDB · ita-fl · CCDB · CromoCat 2015
CCDB · ita-fl — DEN NIJS J.C.M. - 1976. Biosystematic studies of the Rumex acetosella-complex II. The alpine region.. Acta Bot. Neerl. , 25(6): 417-447.
CCDB · CromoCat 2015 — Den Nijs, J. C. M. & van der Hulst, A. W. (1982). Biosystematic studies of the Rumex acetosella complex V. Cytogeography and morphology in the Czech Socialistic Republic and a part of lower Austria. Folia Geobot. Phytotax. (Czech.) 17: 49-62
2n 322×CCDB · book-fedorov
CCDB · book-fedorov — Roth 1906
CCDB · book-fedorov — Kihara, Ono 1923a
2n 562×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Sur l'existence de formes octoplodes chez l'agrgat du Rumex acetosella dans la pninsule Ibrique. Fernandes, A.Rev. Biol.12: 341-362(1983).
CCDB · CromoCat 2015 — Fernandes, A. (1983). Sur l'existence de formes octoploïdes chez l'agrégat du Rumex acetosella dans la péninsule Ibérique. Rev. Biol. 12: 341-362.
2n 301×CCDB · ita-fl
CCDB · ita-fl — DEN NIJS J.C.M. - 1976. Biosystematic studies of the Rumex acetosella-complex II. The alpine region.. Acta Bot. Neerl. , 25(6): 417-447.
2n 331×CCDB · ita-fl
CCDB · ita-fl — DEN NIJS J.C.M. - 1976. Biosystematic studies of the Rumex acetosella-complex II. The alpine region.. Acta Bot. Neerl. , 25(6): 417-447.
2n 341×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Nijs, J. (1976). Biosystematic studies of the Rumex acetosella-complex II. The Alpine region. Acta Bot. Neerl. 25(6):417-447
2n 371×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Nijs, J. (1976). Biosystematic studies of the Rumex acetosella-complex II. The Alpine region. Acta Bot. Neerl. 25(6):417-447
2n 381×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — 41
2n 401×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 13
n 218×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · Cave1963 +1
CCDB · iber-fl — Etudes cytogntiques des Rumex. II Lve, A.Bot. Not.1941: 155-172(1941).
CCDB · ipcn-api-dl — Ward, D. E. 1983. Chromosome counts from New Mexico and southern Colorado. Phytologia 54: 302–309.
CCDB · ipcn-api-dl — Nijs, J. C. M. D., H. Hooghiemstra & P. H. Schalk. 1980. Biosystematic studies of the Rumex acetosella complex (Polygonaceae). IV. Pollen morphology and the possibilities of identification of cytotypes in pollen analysis. Phyton (Horn) 20: 307–323.
CCDB · Cave1963 — Sorsa 1962.
CCDB · CromoCat 2015 — Löve, A. (1941). Etudes cytogénétiques des Rumex. II. Bot. Not. 1941: 155-172.
CCDB · CromoCat 2015 — Nijs, J., H. Hooghiemstra & P. Shalk. (1980). Biosystematic studies of the Rumex acetosella complex. Phyton (Horn) 20: 307-323.
CCDB · CromoCat 2015 — Ward, D. E. (1983a). In: IOPB chromosome number reports LXXX Taxon 32: 510-511
CCDB · CromoCat 2015 — Nijs, J., K. den Sorgdrager & J. Stoop. (1985). Biosystematic studies of the Rumex acetosella complex. IX. Cytogeography of the complex in the Iberian Peninsula and taxonomic discussion. Bot. Helv. 95: 141-156.
n 72×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Etudes cytogntiques des Rumex. II Lve, A.Bot. Not.1941: 155-172(1941).
CCDB · CromoCat 2015 — Nijs, J., K. den Sorgdrager & J. Stoop. (1985). Biosystematic studies of the Rumex acetosella complex. IX. Cytogeography of the complex in the Iberian Peninsula and taxonomic discussion. Bot. Helv. 95: 141-156.
n 142×CCDB · CromoCat 2015 · TreeOfSex · plant
CCDB · CromoCat 2015 — Nijs, J., K. den Sorgdrager & J. Stoop. (1985). Biosystematic studies of the Rumex acetosella complex. IX. Cytogeography of the complex in the Iberian Peninsula and taxonomic discussion. Bot. Helv. 95: 141-156.
TreeOfSex · plant — Goldblatt1979 ↗
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:889-891
n 281×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Nijs, J., K. den Sorgdrager & J. Stoop. (1985). Biosystematic studies of the Rumex acetosella complex. IX. Cytogeography of the complex in the Iberian Peninsula and taxonomic discussion. Bot. Helv. 95: 141-156.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time3.6–0.01 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range3.6–0.01 Ma Pliocene, Pleistocene
Dated fossil finds6
StatusStill living record runs to the present
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Rumex acetosella. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type590 402 records
Wild obs. + sensor552 116
Museum / vouchered36 942
Cultivated / captive277
Fossil33
Other1 034
Origin
Native28 557
Introduced17 326
Range
Area of Occupancy AOO669 284 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy54% within 1 km
≤100 m 128 462≤1 km 120 316≤10 km 206 535>10 km 3 049
458 362 georeferenced · 93 754 without coordinates
Open the mapobservation + sensor552 116
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy35% within 1 km
≤100 m 2 077≤1 km 7 825≤10 km 17 668>10 km 741
28 311 georeferenced · 8 631 without coordinates
Open the institutions mapphysical evidence36 942
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy13% within 1 km
≤1 km 2≤10 km 1>10 km 13
16 georeferenced · 261 without coordinates
Open the mapnot free-living277
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions285 of 536 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 19 746 |
| Moscow State Universitylocation not on record | 543 |
| Madison, US | 457 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 391 |
| Bronx, US | 345 |
| Philadelphia, US | 323 |
| Chongqing Museumlocation not on record | 314 |
| BFLlocation not on record | 272 |
| Berlin, DE | 249 |
| Museo Entomologico de Leonlocation not on record | 240 |
| Saint Louis, US | 238 |
| WTUlocation not on record | 223 |
| Université Lavallocation not on record | 211 |
| Durango, MX | 193 |
| Québec, CA | 190 |
| Salzburg, AT | 189 |
| Adelaide, AU | 186 |
| St. Paul, US | 185 |
| Oulu, FI | 176 |
| IFR-DNFlocation not on record | 170 |
| Oregon State Universitylocation not on record | 169 |
| UniKSlocation not on record | 165 |
| Uniwersytet Warszawskilocation not on record | 165 |
| Moscow, US | 163 |
| Garðabær, IS | 162 |
| Pullman, US | 150 |
| Jyväskylä, FI | 146 |
| MAlocation not on record | 141 |
| Canberra, AU | 136 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 135 |
| Helsinki, FI | 134 |
| Arcata, US | 124 |
| Angwin, US | 122 |
| Oskarshamn, SE | 122 |
| Odawara, JP | 121 |
| Riverside, US | 118 |
| University of Wisconsinlocation not on record | 114 |
| Mexico City, MX | 112 |
| Christchurch, NZ | 111 |
| Hobart, AU | 110 |
| Davis, US | 110 |
| Corvallis, US | 106 |
| Toronto, CA | 104 |
| Tartu, EE | 103 |
| Mount Annan, AU | 103 |
| University of New Hampshirelocation not on record | 103 |
| College Park, US | 99 |
| Chicago, US | 99 |
| Bloomington, US | 98 |
| MeiseBGlocation not on record | 97 |
| Ann Arbor, US | 95 |
| Claremont, US | 89 |
| LDlocation not on record | 87 |
| Auckland, NZ | 81 |
| Provincia di Livornolocation not on record | 78 |
| ASUlocation not on record | 77 |
| Görlitz, DE | 77 |
| TROMlocation not on record | 76 |
| Brisbane, AU | 75 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 74 |
| Missoula, US | 74 |
| Wuzhou, CN | 74 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 70 |
| Boise, US | 69 |
| Acadia Universitylocation not on record | 69 |
| National Biodiversity Institute, Costa Ricalocation not on record | 67 |
| South Kensington, GB | 67 |
| Irkutsk State Universitylocation not on record | 66 |
| Flagstaff, US | 66 |
| Wlocation not on record | 66 |
| University of Stellenboschlocation not on record | 66 |
| BRNUlocation not on record | 66 |
| 65 | |
| Kensington, AU | 63 |
| Entomological Society of Latvialocation not on record | 62 |
| Mexico City, MX | 62 |
| Bozeman, US | 60 |
| Santa Barbara, US | 60 |
| Saint John, CA | 59 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 58 |
| Williamsburg, US | 56 |
| KMNlocation not on record | 55 |
| Montréal, CA | 54 |
| San Luis Obispo, US | 53 |
| Canadian Department of Agriculturelocation not on record | 53 |
| Denver, US | 51 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 51 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 51 |
| Albuquerque, US | 50 |
| Olocation not on record | 50 |
| Bangkok, TH | 48 |
| Chiba, JP | 47 |
| Uppsala, SE | 47 |
| San Diego, US | 44 |
| SLU Artdatabankenlocation not on record | 44 |
| Kew, GB | 43 |
| US | 41 |
| NSMKlocation not on record | 40 |
| TUR-Alocation not on record | 40 |
| Tallinn, EE | 39 |
| CASlocation not on record | 38 |
| Trondheim, NO | 38 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 38 |
| Chapel Hill, US | 38 |
| New Haven, US | 37 |
| Emporia, US | 37 |
| Logan, US | 35 |
| Wellington, NZ | 35 |
| KOMlocation not on record | 34 |
| Norfolk, US | 34 |
| Beijing, CN | 34 |
| Green Bay, US | 33 |
| Bando, JP | 33 |
| Allentown, US | 33 |
| Cheney, US | 32 |
| Turku, FI | 32 |
| DOI/NPS, Greenbelt Parklocation not on record | 31 |
| Zürich, CH | 31 |
| Victoria, CA | 31 |
| Armidale, AU | 31 |
| Chadron, US | 30 |
| Tsukuba, JP | 30 |
| BIO-UNIPIlocation not on record | 29 |
| Phoenix, US | 28 |
| València, ES | 28 |
| Bern, CH | 28 |
| Universidad de La Salle (La Salle)location not on record | 27 |
| Santa Cruz, US | 27 |
| Taipei, TW | 27 |
| Kuopio, FI | 27 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 27 |
| Otaru, JP | 27 |
| Tampa, US | 26 |
| Paris, FR | 26 |
| Uniwersytet Opolskilocation not on record | 26 |
| BClocation not on record | 26 |
| Montréal, CA | 26 |
| Caldwell, US | 26 |
| Zürich, CH | 26 |
| Bergen, NO | 25 |
| KR | 25 |
| Portland, US | 24 |
| BDBClocation not on record | 24 |
| Porvoo, FI | 24 |
| McWane Science Centerlocation not on record | 24 |
| Sanda, JP | 24 |
| Nagatoro-machi, Chichibu-gun, JP | 23 |
| Keene State Universitylocation not on record | 23 |
| Austin, US | 23 |
| Pittsburg, US | 22 |
| UGentlocation not on record | 22 |
| EL PASO, US | 22 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 22 |
| Dekalb, US | 22 |
| Guasave, MX | 22 |
| Barcelona, ES | 22 |
| Taipei, TW | 21 |
| Aarhus, DK | 21 |
| Kushiro City Museumlocation not on record | 21 |
| Vancouver, CA | 21 |
| GJOlocation not on record | 21 |
| Altos de Pipe, VE | 20 |
| Millersville, US | 20 |
| Universidad Nacional de Colombia (UNAL)location not on record | 19 |
| College of the Atlantic, Museumlocation not on record | 19 |
| Rotorua, NZ | 19 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 19 |
| Natural History Museum Rotterdamlocation not on record | 19 |
| National Institute of Biological Resourceslocation not on record | 18 |
| Frankfurt am Main | 18 |
| Córdoba, AR | 18 |
| Fredericton Stock Culture Collectionlocation not on record | 17 |
| Universidad de Caldas (UCaldas)location not on record | 17 |
| University of Alberta Museumslocation not on record | 17 |
| Xiamen, CN | 17 |
| San Isidro, AR | 17 |
| Mlocation not on record | 16 |
| Nanjing, CN | 16 |
| KURAlocation not on record | 16 |
| Salamanca, ES | 16 |
| Hiratsuka City Museumlocation not on record | 16 |
| QCNElocation not on record | 16 |
| Pocatello, US | 15 |
| Dresden, DE | 15 |
| Ashland, US | 15 |
| Provo, US | 15 |
| Anchorage, US | 15 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 15 |
| Knoxville, US | 14 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 14 |
| Whitewater, US | 14 |
| CICYTEXlocation not on record | 13 |
| Kochi, JP | 13 |
| Lincoln, US | 13 |
| Fulda, DE | 13 |
| AASlocation not on record | 13 |
| San Francisco, US | 13 |
| Adam Mickiewicz University in Poznańlocation not on record | 13 |
| Mississippi State, US | 13 |
| PRClocation not on record | 13 |
| Quito, EC | 12 |
| BAYLUlocation not on record | 12 |
| Northridge, US | 12 |
| KIRMlocation not on record | 12 |
| Porrentruy, CH | 12 |
| GZUlocation not on record | 12 |
| Weber State Universitylocation not on record | 12 |
| Edinburgh, GB | 12 |
| La Paz, BO | 12 |
| Nunoa, Santiago, CL | 12 |
| Karlsruhe, DE | 11 |
| Valparaiso, CL | 11 |
| Inner Mongolia Universitylocation not on record | 11 |
| GB | 11 |
| Tacoma, US | 11 |
| Universidad Católica de Santa Maríalocation not on record | 11 |
| Taipei, TW | 11 |
| Puebla, MX | 10 |
| Mexico City, MX | 10 |
| Spearfish, US | 10 |
| La Trobe Universitylocation not on record | 10 |
| Frauenfeld, CH | 9 |
| Bourges, FR | 9 |
| Podgorica, ME | 9 |
| Austin, US | 9 |
| WINlocation not on record | 9 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 9 |
| Staten Island, US | 9 |
| Western Carolina Universitylocation not on record | 9 |
| Nishihara, JP | 9 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 9 |
| Rovaniemi, FI | 9 |
| Sagamihara, JP | 9 |
| Dover, US | 9 |
| Parthenon Tama History Museumlocation not on record | 9 |
| Kingston, US | 8 |
| Blumenau, BR | 8 |
| New Brunswick, US | 8 |
| Stockholm, SE | 8 |
| Philadelphia, US | 8 |
| China Agricultural Universitylocation not on record | 8 |
| Universidad de Nariño (UdeNar)location not on record | 8 |
| Universidad Industrial de Santander (UIS)location not on record | 8 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 8 |
| Durango, US | 8 |
| Tilburg, NL | 8 |
| GAlocation not on record | 8 |
| Tuscaloosa, US | 8 |
| Tomioka, JP | 7 |
| Mohonk Preservelocation not on record | 7 |
| UChlocation not on record | 7 |
| Korea National Arboretumlocation not on record | 7 |
| Fayetteville, US | 7 |
| Institute of the biological problems of the North FEB RASlocation not on record | 7 |
| Göteborg, SE | 7 |
| Fort Worth, US | 7 |
| Kandalaksha State Nature Reservelocation not on record | 7 |
| Chengdu, CN | 7 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 7 |
| Ypsilanti, US | 7 |
| Parkville, AU | 7 |
| Bend, US | 7 |
| John T. Waterhouse Herbariumlocation not on record | 7 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 7 |
| BSBIlocation not on record | 7 |
| Valdosta State Universitylocation not on record | 7 |
| Uniwersytet Śląski w Katowicachlocation not on record | 7 |
| Washington, US | 7 |
| PrivatHerblocation not on record | 6 |
| DBF-NHMDlocation not on record | 6 |
| Coimbra, PT | 6 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 6 |
| Fairfax, US | 6 |
| Buenos Aires, AR | 6 |
| Lord Fairfax Community Collegelocation not on record | 6 |
| Tokushima, JP | 6 |
| NMBU:MINAlocation not on record | 6 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 6 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 6 |
| Hamilton, US | 5 |
| Burlington, US | 5 |
| DMZ botanic gardenlocation not on record | 5 |
| Shanghai, CN | 5 |
| Wuhan, CN | 5 |
| Torreón, MX | 5 |
| Severin-McDaniel Insect Collectionlocation not on record | 5 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 5 |
| Durham, US | 5 |
| STNFlocation not on record | 5 |
| BGBMlocation not on record | 5 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 5 |
| Columbia, US | 5 |
| Cuenca, EC | 5 |
| QVMAGlocation not on record | 5 |
| San José, CR | 5 |
| Valparaíso, CL | 5 |
| Macomb, US | 5 |
| Davenport, US | 5 |
| Forssa, FI | 5 |
| Namur, BE | 5 |
| Peking Universitylocation not on record | 5 |
| TAIElocation not on record | 5 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 5 |
| BISHlocation not on record | 5 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 5 |
| Brookings, US | 5 |
| Muséum Henri Lecoqlocation not on record | 4 |
| Palmerston, AU | 4 |
| Mount Pleasant, US | 4 |
| FLADlocation not on record | 4 |
| Iwate Prefectural Museumlocation not on record | 4 |
| Ivano-Frankivsk, UA | 4 |
| Morgantown, US | 4 |
| Whitehorse, CA | 4 |
| SZUlocation not on record | 4 |
| Northeastern Forestry Universitylocation not on record | 4 |
| Museum of the Rockieslocation not on record | 4 |
| Chicago, US | 4 |
| USFSlocation not on record | 4 |
| Portland, US | 4 |
| Fullerton, US | 4 |
| Cape Town, ZA | 4 |
| San Jose, US | 4 |
| Madrid, ES | 4 |
| Guangzhou, CN | 4 |
| Montecillo, Texcoco, MX | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| AUAlocation not on record | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| Samara National Research Universitylocation not on record | 4 |
| USFS/BHSClocation not on record | 4 |
| Kawasaki Shi Tama Ku, JP | 4 |
| University of Southern Mississippilocation not on record | 4 |
| Kunming, CN | 4 |
| Ciudad de México, MX | 4 |
| SEFlocation not on record | 4 |
| Sion, CH | 4 |
| Durham, US | 4 |
| University of Tennessee at Chattanoogalocation not on record | 4 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 4 |
| Riobamba, EC | 4 |
| Arequipa, PE | 4 |
| Long Beach, US | 4 |
| Turlock, US | 4 |
| MEXUlocation not on record | 4 |
| San Angelo, US | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| USP-IBlocation not on record | 3 |
| Corrientes, AR | 3 |
| Nishihara, JP | 3 |
| Santa Cruz de la Sierra, BO | 3 |
| IDElocation not on record | 3 |
| Richmond, US | 3 |
| Little Rock, US | 3 |
| Monastir, TN | 3 |
| Minia, EG | 3 |
| Morelia, MX | 3 |
| Herbario Universidad de Concepciónlocation not on record | 3 |
| UIBlocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Los Angeles, US | 3 |
| Wollongong, AU | 3 |
| Kirksville, US | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| Osaka, JP | 3 |
| Umeå Universitylocation not on record | 3 |
| Smithfield, AU | 3 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 3 |
| Sucre, BO | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Mérida, MX | 3 |
| University of Helsinkilocation not on record | 3 |
| Loja, EC | 3 |
| Johnson City, US | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| Shanghai, CN | 3 |
| Philadelphia, US | 3 |
| KNAMlocation not on record | 3 |
| CPATSAlocation not on record | 3 |
| Badajoz, ES | 3 |
| Laboratorio de Ictiologialocation not on record | 3 |
| Denton, US | 3 |
| Meguro Parasitological Museumlocation not on record | 3 |
| Oswego, US | 3 |
| JBRJlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 3 |
| Universidad Católica de Oriente (UCO)location not on record | 3 |
| Yugra State University Biological Collectionlocation not on record | 3 |
| HJAEFlocation not on record | 2 |
| EMTCMlocation not on record | 2 |
| PUC-RSlocation not on record | 2 |
| Zhengzhou, CN | 2 |
| Palmerston North, NZ | 2 |
| Chicago, US | 2 |
| Cusco, PE | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| Vitoria, ES | 2 |
| Guatemala City, GT | 2 |
| HUAlocation not on record | 2 |
| Honolulu, US | 2 |
| Tromso University Museumlocation not on record | 2 |
| Pacific Lutheran Universitylocation not on record | 2 |
| UoB-IBlocation not on record | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 2 |
| Guilin, CN | 2 |
| UC Berkeley, Blue Oak Ranch Reservelocation not on record | 2 |
| VALElocation not on record | 2 |
| Orem, US | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Kyoto Universitylocation not on record | 2 |
| Clemson, US | 2 |
| Rocky Mountain Biological Laboratorylocation not on record | 2 |
| Bothell, US | 2 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 2 |
| Giardini Botanici Hanburylocation not on record | 2 |
| Cochabamba, BO | 2 |
| Zapopan, MX | 2 |
| Sevilla, ES | 2 |
| La Paz, MX | 2 |
| Córdoba, ES | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Toyota city nature sanctuarylocation not on record | 2 |
| Fribourg, CH | 2 |
| DNSMlocation not on record | 2 |
| Fredericksburg, US | 2 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 2 |
| Trois-Rivières, CA | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Henderson, US | 2 |
| DASSHlocation not on record | 2 |
| Black Rock Forest Consortiumlocation not on record | 2 |
| Finnish Museum of Natural Historylocation not on record | 2 |
| H-AkrKGlocation not on record | 1 |
| OTSlocation not on record | 1 |
| Herbario UTCEClocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Criciúma, BR | 1 |
| Feira de Santana, BR | 1 |
| UFPIlocation not on record | 1 |
| UFPRlocation not on record | 1 |
| Due West, US | 1 |
| IPA/SPlocation not on record | 1 |
| UFAClocation not on record | 1 |
| UFMSlocation not on record | 1 |
| UNESClocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Hudson, US | 1 |
| BG-NMNHSlocation not on record | 1 |
| FFPRIlocation not on record | 1 |
| San Bernardino, US | 1 |
| Grand Junction, US | 1 |
| GNWPlocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Chapingo, MX | 1 |
| Tlalnepantla, MX | 1 |
| H-Adlerlocation not on record | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Lubbock, US | 1 |
| WNNUlocation not on record | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Seoul, KR | 1 |
| Mexico City, MX | 1 |
| Ivano-Frankove, UA | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| UNICAMPlocation not on record | 1 |
| PRlocation not on record | 1 |
| US | 1 |
| nbflocation not on record | 1 |
| ESP109location not on record | 1 |
| LUXEMBOURG, LU | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| arosemena tola, EC | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| University of Copenhagenlocation not on record | 1 |
| xMDC-Clintonlocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| WAGlocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Culiacán, MX | 1 |
| Students On Ice Foundationlocation not on record | 1 |
| Kiritappu Wetland National Trustlocation not on record | 1 |
| Santiago, CL | 1 |
| Lanzhou, CN | 1 |
| Yangling, CN | 1 |
| FLASlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| CJBNlocation not on record | 1 |
| IMMUlocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Wake Forest Universitylocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| KNFHClocation not on record | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Jishou Universitylocation not on record | 1 |
| Awka, NG | 1 |
| Ishikawa Museum of Natural Historylocation not on record | 1 |
| OLAlocation not on record | 1 |
| Russellville, US | 1 |
| Lausanne, CH | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Clocation not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Brasília, BR | 1 |
| DAOlocation not on record | 1 |
| Zlocation not on record | 1 |
| INBIOlocation not on record | 1 |
| Gifu prefectural Museumlocation not on record | 1 |
| Jefferson City, US | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Tapachula, MX | 1 |
| Copenhagen, DK | 1 |
| Mount Berry, US | 1 |
| Irvine, US | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| US | 1 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 1 |
| Beijing, CN | 1 |
| Santiago de Compostela, ES | 1 |
| GINRlocation not on record | 1 |
| Baltimore, US | 1 |
| Brussel, BE | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| LfUlocation not on record | 1 |
| DULlocation not on record | 1 |
536 institutions · 35 266 of 36 942 vouchered records shown · 1 306 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA36 detections
Where the DNA of Rumex acetosella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found36
Studies independent surveys1
Countries9
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 36 detections have coordinates
Open the map9 countries0
woods on edge of marsh with geranium, abies,…At the edge of an open meadow, Quercus agrif…lawn
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.1 °C 3.70–18.4
Seasonal swing summer↔winter15.4 °C
Max temp (day)16.2 °C 5.20–23.6
Min temp (night)9.10 °C 2.00–13.7
Precipitation70.4 mm/mo 30.9–103
Air humidity60.3 % 54.4–66.7
Moisture balance-35.5 mm/mo -94.9–53.2
Vapour deficit595 Pa 285–911
Wind speed3.30 m/s 2.70–6.80
Cloud cover42.0 % 37.4–52.1
CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.