Rubus trilobus — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Rubus

At a glance

Occurrence records319

Data sources9

Biological traits8

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Rubus trilobus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility319 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF319 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Rubus trilobus, the boulder raspberry or delicious raspberry, is Mesoamerican species of flowering plant in the rose family. It is native to Guatemala and to southern and central Mexico (Chiapas, Oaxaca, Veracruz, Puebla, Tlaxcala).García-Mendoza, A. J. & J. A. Meave. 2011. Diversidad Florística de Oaxaca: de Musgos a Angispermas 1–351. Universidad Nacional Autónoma de México, Ciudad UniversitariaBreedlove, D.E. 1986. Flora de Chiapas. Listados Florísticos de México 4: i–v, 1–246.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition2 compounds

Compounds documented for Rubus trilobus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Gallotannins2

Documented compounds2 total

Compound	Class	Amount	Source
[(10R,11R)-10-[(15S,19S)-2,3,4,7,8,9,19-heptahydroxy-12,17-dioxo-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaen-14-yl]-3,4,5,17,18,19-hexahydroxy-8,14-dioxo-9,13-dioxatricyclo[13.4.0.02,7]nonadeca-1(19),2,4,6,15,17-hexaen-11-yl] 3,4,5-trihydroxybenzoate		present	LOTUS
Lambertianin A		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rubus trilobus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF055738.1 ↗629 bp

ACGT

TCGAAACCTGCCCAGCAGAACGACCCGAGCACATGTTTCAACGCTTGGGGGCGAAGGGTCTCACGGCTCCTCGTCCCTTTTCTCGGGAGG …

Rubus trilobus internal transcribed spacer 1, 5.8S ribosomal RNA gene; and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1ITS2

fungal barcode

08Occurrence & distribution

Record type319 records

Wild obs. + sensor84

Museum / vouchered234

Other1

Range

Area of Occupancy AOO592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 34≤1 km 18≤10 km 4>10 km 1

57 georeferenced · 27 without coordinates

Open the mapobservation + sensor84

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 111≤1 km 5≤10 km 10>10 km 4

130 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence234

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	93
Mexico City, MX	27
Saint Louis, US	21
Austin, US	15
Tapachula, MX	12
Austin, US	9
MEXUlocation not on record	9
Tuxtla Gutiérrez, MX	9
CASlocation not on record	4
Tuxtla Gutiérrez, MX	3
SCAUlocation not on record	3
Ciudad de México, MX	3
San Francisco, US	2
Chapingo, MX	2
GB	2
Giardini Botanici Hanburylocation not on record	2
NO DISPONIBLElocation not on record	2
Mexico City, MX	1
Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record	1
Riverside, US	1
Tampa, US	1
Kew, GB	1
San Diego, US	1
Juriquilla, MX	1
Chongqing Museumlocation not on record	1
ASUlocation not on record	1
University of Stellenboschlocation not on record	1
LDlocation not on record	1
WTUlocation not on record	1

29 institutions · 230 of 234 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Rubus trilobus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.