Rubus tricolor

Focke · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Rubus

At a glance

Occurrence records3 083

Data sources11

Biological traits25

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Rubus tricolor's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 083 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF3 083 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 28

01Narrative

Rubus tricolor est une espèce de plantes à fleurs de la famille des rosacées. Synonyme : Rubus polytrichus (Franchet.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology15

Fruit length17 mm

Fruit length max17 mm

Fruit length min17 mm

Fruit width17 mm

Fruit width max17 mm

Fruit width min17 mm

Leaf length90 mm

Leaf length max120 mm

Leaf length min60 mm

Leaf width55 mm

Leaf width max80 mm

Leaf width min30 mm

Plant height2.5 m

Plant height max4 m

Plant height min1 m

Life cycle & reproduction4

Flower length max30 mm

Flower length min20 mm

Life formshrub or tree

Life spanperennial

Habitat & environment6

Climberself-supporting

Elevation max3 600 m

Elevation mean2 700 m

Elevation min1 800 m

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Climber

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rubus tricolor has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF055753.1 ↗628 bp

ACGT

TCGAAACCTGCCCAGCAGAACGACCCGAGAACATGTTTCAACGCTTGGGGGCGAAGGGTCCTACGGCTCCTCGTCCCTTTTCTCGGGAGG …

Rubus tricolor internal transcribed spacer 1, 5.8S ribosomal RNA gene; and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Rubus tricolor carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records28–282n range28median28mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 284×GoaT · Tree of Sex Database · CCDB · nw-europe-fl · CCDB · ipcn-api-dl +1

GoaT · Tree of Sex Database — ↗

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2604

CCDB · ipcn-api-dl — Iwatsubo, Y. & N. Naruhashi. 1993. Cytotaxonomical studies of Rubus (Rosaceae) II. Chromosome numbers of 21 species and 6 natural hybrids. J. Jap. Bot. 68: 159–165.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 083 records

Wild obs. + sensor2 953

Museum / vouchered116

Cultivated / captive2

Other12

Origin

Introduced513

Range

Area of Occupancy AOO6 632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 1 308≤1 km 370≤10 km 1 000>10 km 6

2 684 georeferenced · 269 without coordinates

Open the mapobservation + sensor2 953

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 3≤10 km 5

8 georeferenced · 108 without coordinates

Open the institutions mapphysical evidence116

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	24
Chengdu, CN	21
Cambridge, US	14
Kunming, CN	8
Yangling, CN	8
Guangzhou, CN	7
Chengdu, CN	6
Seoul, KR	5
Provincia di Livornolocation not on record	4
University of Stellenboschlocation not on record	3
Edinburgh, GB	3
Guilin, CN	3
Nanjing, CN	2
BSBIlocation not on record	2
Southwest Forestry Collegelocation not on record	2
Taipei, TW	1
South China Normal Universitylocation not on record	1

17 institutions · 114 of 116 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Rubus tricolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Rubus tricolor

At a glance

Sources11 archives

Size & morphology15

Life cycle & reproduction4

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 083 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type3 083 records