Rubus arcticus
speciesAt a glance
Occurrence records42 848
Data sources18
Biological traits114
DNA specimens40
eDNA detections31
Sources18 archives
Databases and archives Rubus arcticus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility42 848 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics40 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources114 traits
Chemical compositionFooDB · LOTUS · NPASS5 557 compounds
Occurrence & distributionGBIF42 848 records
Environmental DNA3 datasets · 6 countries31 detections
DNA & barcodingBOLD · NCBI40 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex2n = 14
01Narrative
Rubus arcticus, la Ronce arctique, Framboise arctique ou Framboisier nain, est une espèce de plantes à fleurs de la famille des Rosacées. C'est une ronce à croissance lente.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesLEDAGIFTWCVPUSDATRY
Size & morphology9
Leaf length40 mm
Leaf length max50 mm
Leaf length min30 mm
Leaf size1 634 mm²
Plant height0.25 m
⚠ sources differ — GIFT: 0.25 m · USDA: 0.305 m · TRY: 0.272 m
Plant height generative0.099 m
Plant height max0.3 m
Plant height min0.1 m
Seed mass1.68 mg
Life cycle & reproduction27
Bloom periodSummer
Coppice potentialNo
Dispersal typeanimal
Flower colourred
Flower conspicuousNo
Flower length max20 mm
Flower length min10 mm
Flowering endJul
Flowering startJul
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formsubshrub
Life spanperennial
Lifespan categoryShort
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormYes
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Resprout abilityYes
Seedling vigorHigh
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment28
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsNo
Aquaticterrestrial
BloatNone
Climatesubalpine or subarctic
Climberself-supporting
Elevation max1 200 m
Elevation mean1 200 m
Elevation min1 200 m
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourred
Growth formshrub
⚠ sources differ — GIFT: shrub · TRY: Subshrub, Forb/herb
Growth form USDARhizomatous
Habitat GIFTforest, meadows: wet, shrubberies, swamps, tundra
Hedge toleranceNone
Known allelopathNo
Leaf formrhomboid
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min12 in
Small grainNo
Woodinessvariable
⚠ sources differ — TRY: non-woody/woody · GIFT: woody
Physiology & chemistry23
Anaerobic toleranceMedium
C:N ratioMedium
Caco3 toleranceHigh
Cold stratification requiredYes
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceLow
Frost free days min120 days
Leaf c440 mg/g
Leaf dry-matter content (LDMC)318 mg/g
Leaf n20.77 mg/g
Leaf p2.08 mg/g
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max79 in
Precipitation min10 in
Salinity toleranceNone
Shade toleranceHigh
Soil pH max7 pH
Soil pH min5 pH
Specific leaf area (SLA)21.09 mm²/mg
⚠ sources differ — TRY: 21.09 mm²/mg · GIFT: 29.63 mm²/mg
Temperature min-62 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable graze animalLow
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound270 000 per lb
ToxicitySlight
Veneer productNo
Other traits11
Fall conspicuousNo
Fruit seed conspicuousNo
Fruit seed persistenceYes
Height at 20yr0.61 m
Leaf margintoothed
Leaf spinesno
Leaf thornsno
Planting density max1 280 per acre
Planting density min320 per acre
Sla max29.63 mm²/mg
Sla min29.63 mm²/mg
03Chemical composition5 557 compounds
Compounds documented for Rubus arcticus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingFruits
Compound class profile5 classes
Aminoacids67
Glycerophospholipids57
Cinnamic acids and derivatives30
Purine nucleos(t)ides26
Monosaccharides25
Documented compounds5 557 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Cyanidin | 88.3 mg/100 g | FooDB | |
| Ellagic acid | 17.15 mg/100g | FooDB | |
| Quercetin | 9.1 mg/100 g | FooDB | |
| alpha-Catechin | 1.8 mg/100 g | FooDB | |
| Isorhamnetin | 1.4 mg/100 g | FooDB | |
| Pelargonidin | 0.7 mg/100 g | FooDB | |
| Kaempferol | 0.15 mg/100 g | FooDB | |
| Myricetin | 0 mg/100 g | FooDB |
05DNA & barcoding40 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rubus arcticus has left across the world's sequence archives.
At a glance
DNA specimens40
Marker genes6
GenBank sequences10
eDNA detections31
Countries6
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTC …
Rubus arcticus subsp. acaulis voucher CCDB-23110-B12 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL4★rbcLa★ITS5★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Rubus arcticus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–142n range14median14mode30records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1430×GoaT · Tree of Sex Database · CCDB · iapt · CCDB · nw-europe-fl +12
GoaT · Tree of Sex Database — ↗
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2606
CCDB · fl-europaea — Sokolovskaya &
CCDB · ipcn-api-dl — Yurtsev, B. A. & P. G. ZHUKOVA. 1982. Chromosome numbers of some plants of the northeastern Yakutia (the drainage of the Indigirka River in its middle reaches). Bot. Zhurn. 67 (6): 778–787. (In Russian).
CCDB · ipcn-api-dl — Belaeva, V. A. & V. Siplivinsky. 1981. In Chromosome number reports LXXIII. Taxon 30: 857–860.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · ipcn-api-dl — Kotimaki, M. & H. Hiirsalmi. 1979. Cytogenetic studies on Rubus arcticus, Rubus stellatus and their hybrids. Hereditas 91: 83–89.
CCDB · ipcn-api-dl — Yang. 2005. A cytotaxonomical study of Rubus (Rosaceae) in Korea. Korean J. Pl. Taxon. 35: 129–142.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · book-ipcn66 — Love &Ritchie 1966
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-ipcn67-71 — LARSSON, G. 1969. Experimental taxonomy as a base for breeding of northern Rubi. Hereditas 63: 283-351.
CCDB · book-ipcn75-78 — Belaeva & Siplivinsky 1975
CCDB · book-ipcn75-78 — Zhukova et al. 1977a
CCDB · book-northern-plants — Vaarama 1939.
CCDB · eflora
CCDB · book-fedorov — Vaarama 1939
CCDB · book-fedorov — Larsson 1957
CCDB · book-fedorov — CoROJIOBC){all 1960a
CCDB · book-fedorov — CoRoJIOBCRan, CTpeJIROBa 1960, 1962
CCDB · book-atlas-flowering-plants — Vaarama 1939
CCDB · book-atlas-flowering-plants — Vaarama 1954
CCDB · Cave1959 — Vaarama 1954a
CCDB · Cave1963 — Sokol. & Strel. 1962
TreeOfSex · plant — Goldblatt1979 ↗
2n 212×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl
GoaT · Tree of Sex Database — ↗
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type42 848 records
Wild obs. + sensor38 648
Museum / vouchered4 110
Cultivated / captive27
Other63
Origin
Native9
Introduced1
Range
Area of Occupancy AOO99 544 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy79% within 1 km
≤100 m 11 754≤1 km 17 050≤10 km 6 271>10 km 1 417
36 492 georeferenced · 2 156 without coordinates
Open the mapobservation + sensor38 648
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy23% within 1 km
≤100 m 164≤1 km 540≤10 km 938>10 km 1 374
3 016 georeferenced · 1 094 without coordinates
Open the institutions mapphysical evidence4 110
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy95% within 1 km
≤100 m 20≤1 km 1≤10 km 1
22 georeferenced · 5 without coordinates
Open the mapnot free-living27
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions53 of 103 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 887 |
| Moscow State Universitylocation not on record | 490 |
| LDlocation not on record | 339 |
| Uppsala, SE | 323 |
| Oulu, FI | 245 |
| Olocation not on record | 229 |
| Jyväskylä, FI | 169 |
| TROMlocation not on record | 137 |
| Turku, FI | 129 |
| Kuopio, FI | 111 |
| Trondheim, NO | 109 |
| Oskarshamn, SE | 78 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 69 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 40 |
| TUR-Alocation not on record | 35 |
| Porvoo, FI | 30 |
| SLU Artdatabankenlocation not on record | 20 |
| Rovaniemi, FI | 20 |
| WTUlocation not on record | 20 |
| Philadelphia, US | 20 |
| Victoria, CA | 18 |
| University of Alberta Museumslocation not on record | 14 |
| Tartu, EE | 13 |
| Tallinn, EE | 13 |
| Montréal, CA | 12 |
| University of Stellenboschlocation not on record | 11 |
| Adam Mickiewicz University in Poznańlocation not on record | 11 |
| Vancouver, CA | 11 |
| Anchorage, US | 10 |
| BRNUlocation not on record | 10 |
| Chongqing Museumlocation not on record | 10 |
| KMNlocation not on record | 9 |
| Northeastern Forestry Universitylocation not on record | 9 |
| Görlitz, DE | 9 |
| Université Lavallocation not on record | 9 |
| IWEP FEB RASlocation not on record | 9 |
| Kandalaksha State Nature Reservelocation not on record | 8 |
| Bronx, US | 7 |
| MeiseBGlocation not on record | 7 |
| Stockholm, SE | 7 |
| Bergen, NO | 6 |
| Forssa, FI | 6 |
| St. Paul, US | 6 |
| South Kensington, GB | 6 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 5 |
| nbflocation not on record | 5 |
| Kyoto Universitylocation not on record | 5 |
| Paris, FR | 5 |
| Servico de Microbiologia e Imunologialocation not on record | 4 |
| Acadia Universitylocation not on record | 4 |
| Guangzhou, CN | 4 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 4 |
| Yukon Universitylocation not on record | 4 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 4 |
| BClocation not on record | 3 |
| Provincia di Livornolocation not on record | 3 |
| Québec, CA | 3 |
| Dresden, DE | 3 |
| University of Lethbridgelocation not on record | 3 |
| Tsukuba, JP | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Churchill Northern Studies Centrelocation not on record | 3 |
| Porrentruy, CH | 2 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 2 |
| Tempe, US | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| WINlocation not on record | 2 |
| Kew, GB | 2 |
| Toronto, CA | 2 |
| Institute of the biological problems of the North FEB RASlocation not on record | 2 |
| Wellington, NZ | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| BMlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| Philadelphia, US | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Washington, US | 1 |
| Karlsruhe, DE | 1 |
| Bloomington, US | 1 |
| Göteborg, SE | 1 |
| Nanjing, CN | 1 |
| Wlocation not on record | 1 |
| Missoula, US | 1 |
| Walla Walla, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Yugra State University Biological Collectionlocation not on record | 1 |
| GB | 1 |
| Frankfurt am Main | 1 |
| Bangkok, TH | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Chinese Academy of Forestrylocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Provo, US | 1 |
| Riverside, US | 1 |
| Dekalb, US | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Berlin, DE | 1 |
| Denver, US | 1 |
| Guilin, CN | 1 |
| Jackson, US | 1 |
103 institutions · 3 856 of 4 110 vouchered records shown · 252 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA31 detections
Where the DNA of Rubus arcticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found31
Studies independent surveys3
Countries6
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 31 detections have coordinates
Open the map6 countries0
Inland sand flats and low ridge.Pine-spruce forest.Mesic to Subhygric Low Shrub - Herb on unsor…edge of cattail marsh inland from beach ridge.Along shore of lake.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.1 °C 10.0–16.4
Seasonal swing summer↔winter27.0 °C
Max temp (day)16.7 °C 14.6–20.3
Min temp (night)8.80 °C 5.50–12.5
Precipitation89.2 mm/mo 73.7–157
Air humidity60.7 % 57.2–62.9
Moisture balance-6.40 mm/mo -37.1–65.9
Vapour deficit623 Pa 484–759
Wind speed3.20 m/s 2.10–6.10
Cloud cover46.4 % 36.8–56.8
CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.