Rubroboletus lupinus

(Fr.) Costanzo, Gelardi, Simonini & Vizzini · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Boletaceae/Rubroboletus

At a glance

Occurrence records143

Data sources8

Biological traits0

DNA specimens0

eDNA detections1

Sources8 archives

Databases and archives Rubroboletus lupinus's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility143 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF143 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Rubroboletus lupinus, commonly known as the wolf bolete, is a bolete fungus of the genus Rubroboletus. Originally described by Elias Magnus Fries in 1838 as species of Boletus, it was transferred to Rubroboletus in 2015, a genus circumscribed to host other allied reddish-colored, blue-staining bolete species forming a distinct clade. The species epithet is derived from the Latin word lupus, meaning "wolf". Molecular studies have revealed considerable genetic variation among European populations of R. lupinus, placing it in a clade sister to Rubroboletus dupainii. The species is found in warm broad-leaved forests, forming ectomycorrhizal associations with various species of oak (Quercus) and sweet chestnut (Castanea).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rubroboletus lupinus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPZ340626.1 ↗677 bpFrance · 2020

ACGT

GGGGGGAGGGAAGATGGGGAAGGGATGGAGACTGTCGCTGGCCTCTCGGGGCATGTGCACGTCTTCCTTCTCGGTCGACCCTTTCTCTTT …

Rubroboletus lupinus voucher CORS:FNG/LPRC7305 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type143 records

Wild obs. + sensor117

Museum / vouchered25

Other1

Range

Area of Occupancy AOO440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 40≤1 km 22≤10 km 14>10 km 22

98 georeferenced · 19 without coordinates

Open the mapobservation + sensor117

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 3≤1 km 3≤10 km 2

8 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BDBClocation not on record	9
Vitoria, ES	5
Staten Island, US	3
WU-MYClocation not on record	3
Helsinki, FI	1
ILLSlocation not on record	1
Zürich, CH	1
San Sebastián, ES	1

8 institutions · 24 of 25 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Rubroboletus lupinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 15.4–15.4

Seasonal swing summer↔winter15.3 °C

Max temp (day)20.5 °C

Min temp (night)10.4 °C

Precipitation70.4 mm/mo

Air humidity57.7 %

Moisture balance-28.0 mm/mo

Vapour deficit804 Pa

Wind speed2.90 m/s

Cloud cover41.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)