Rubroboletus haematinus — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Boletales/Boletaceae/Rubroboletus

At a glance

Occurrence records34

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Rubroboletus haematinus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility34 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF34 records

DNA & barcodingNCBIsequences

01Narrative

Rubroboletus haematinus is a bolete fungus of the genus Rubroboletus. First described scientifically in 1976 by Roy Halling as a species of Boletus, in 2015 it was transferred to Rubroboletus, a genus circumscribed the year previously to contain other allied reddish colored, blue-staining bolete species. It is found in the western United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Rubroboletus haematinus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKY713597.1 ↗592 bpUSA · 2016

ACGT

AAGACTGTCGCTGGCCCCTCGGGGCAGTGCACGTCTTCCTTTTCGTTGACCTTCCTCTTTCTCTCACCACACACACCTGTGCACCTATTG …

Rubroboletus haematinus voucher JLF4532 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

08Occurrence & distribution

Record type34 records

Wild obs. + sensor33

Museum / vouchered1

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 10≤1 km 3≤10 km 5>10 km 10

28 georeferenced · 5 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.