Roridomyces roridus

(Fr.) Rexer · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Mycenaceae/Roridomyces

At a glance

Occurrence records3 656

Data sources10

Biological traits0

DNA specimens9

eDNA detections97

Sources10 archives

Databases and archives Roridomyces roridus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 656 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI97 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 656 records

Environmental DNA5 datasets · 7 countries97 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceGoaT · NCBI≈91 Mbp

01Narrative

Roridomyces roridus, commonly known as the dripping bonnet or the slippery mycena, is a species of agaric fungus in the family Mycenaceae. It is whitish or dirty yellow in color, with a broad convex cap 5 – in diameter. The stipe is covered with a thick, slippery slime layer. This species can be bioluminescent, and is one of the several causative species of foxfire.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Roridomyces roridus has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes2

GenBank sequences10

eDNA detections97

Countries7

The DNA barcodea real sequence read deposited for this species

ITSPZ354566.1 ↗295 bpUSA · 1935

ACGT

GAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCTTTAATATCTATCAACCATTTTGTGTGCTTGCATGCAG …

Roridomyces roridus clone 4612 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Roridomyces roridus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈91 122 911 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Roridomyces roridus0.09 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type3 656 records

Wild obs. + sensor3 375

Museum / vouchered278

Other3

Range

Area of Occupancy AOO9 524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 733≤1 km 344≤10 km 1 775>10 km 121

2 973 georeferenced · 402 without coordinates

Open the mapobservation + sensor3 375

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 57≤1 km 75≤10 km 40>10 km 4

176 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence278

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	41
Joensuu, FI	23
Universidade de Lisboa, Museu Bocagelocation not on record	14
San Sebastián, ES	13
IB FRC Komi SC UB RASlocation not on record	10
BDBClocation not on record	8
SLU Artdatabankenlocation not on record	8
TENN-Flocation not on record	8
TROMlocation not on record	7
Trondheim, NO	6
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	6
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	5
California State University, East Baylocation not on record	4
Görlitz, DE	4
Oulu, FI	3
Philadelphia, US	3
Odawara, JP	3
Karlsruhe, DE	2
Brisbane, AU	2
Kew, GB	2
Kensington, AU	1
Stockholm, SE	1
Museo Entomologico de Leonlocation not on record	1
CJBGlocation not on record	1
Kuopio, FI	1
University of Warsawlocation not on record	1
TFC Miclocation not on record	1
LDlocation not on record	1
JA-CAGPDS-CAMlocation not on record	1
Southeastern Louisiana University, Vertebrate Museumlocation not on record	1
DPIlocation not on record	1
Research Collection of Steve Nesslocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
Gijón, ES	1
Canberra, AU	1
Helsinki, FI	1
WU-MYClocation not on record	1
nsnflocation not on record	1

38 institutions · 190 of 278 vouchered records shown · 88 without an institution code

09Environmental DNA97 detections

Where the DNA of Roridomyces roridus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found97

Studies independent surveys5

Countries7

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 97 detections have coordinates

Open the map7 countries0

Gammel bokeskog, rik sumpskog, og rik edello…in Juniperus, on dead needles, with M. citri…Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH4.25 3.70–4.70

Conductivity99.0 µS/cm 36.0–164

Organic carbon4.40 % 3.12–5.44

Water content41.5 % 32.3–57.1

Nitrate-N62.0 mg/kg 2.00–86.0

Phosphorus11.5 mg/kg 3.00–20.0

Clay10.8 % 1.81–32.5

Sand31.3 % 19.9–40.3

Depth0.1 m 0–0.2

SoilSodosolDermosol

4 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 5.60–17.2

Seasonal swing summer↔winter22.2 °C

Max temp (day)14.6 °C 8.40–20.9

Min temp (night)8.10 °C 3.10–12.9

Precipitation69.2 mm/mo 49.8–92.7

Air humidity62.3 % 57.6–69.0

Moisture balance-4.20 mm/mo -55.1–57.7

Vapour deficit476 Pa 292–781

Wind speed3.40 m/s 2.30–4.80

Cloud cover42.9 % 35.6–56.3

CHELSA 1981–2010, ~9 km grid, at location & month of 95 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Roridomyces roridus

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 656 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type3 656 records