Romalea microptera

(Palisot de Beauvois, 1817) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Romaleidae/Romalea

At a glance

Occurrence records20 364

Data sources10

Biological traits0

DNA specimens26

eDNA detections24

Sources10 archives

Databases and archives Romalea microptera's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility20 364 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS40 compounds

Occurrence & distributionGBIF20 364 records

Environmental DNA1 datasets · 1 countries24 detections

DNA & barcodingBOLD26 specimens

Genome at a glanceGoaT2n = 24

01Narrative

Romalea is a genus of grasshoppers native to the Southeastern and South-central United States. Its single species is Romalea microptera, known commonly as the eastern lubber grasshopper, Florida lubber, or Florida lubber grasshopper. It is the most distinctive grasshopper species within the Southeastern US, and is well known for its size and its unique coloration. It can reach nearly 3 in in size. It is the type genus and species of the relatively new family Romaleidae and tribe Romaleini, and was long known as Romalea microptera before being moved to Romalea guttata. After new research, though, the remaining names (including guttata) have been marked as nomina oblita and microptera takes priority once more.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition40 compounds

Compounds documented for Romalea microptera across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Ahp-containing cyclodepsipeptides $ Cyclic peptides $ Depsipeptides6

Cyclic peptides5

Carotenoids (C40, β-β)5

Cyclic peptides $ Microcystins4

Aeruginosins $ Linear peptides2

Documented compounds40 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-N-[(2S,5S,8S,11R,12S,15S,18S,21R)-5-benzyl-2,8-bis[(2S)-butan-2-yl]-15-[[(1S,4R)-4-hydroxycyclohex-2-en-1-yl]methyl]-21-methoxy-4,11-dimethyl-3,6,9,13,16,22-hexaoxo-10-oxa-1,4,7,14,17-pentazabicyclo[16.3.1]docosan-12-yl]-2-[[(2R)-3-hydroxy-2-methoxypropanoyl]amino]-4-(4-hydroxyphenyl)butanamide	present	NPASS
(2S)-2-[[(3S,6S,9S,12S,15R)-3,12-bis[(2S)-butan-2-yl]-6,9-bis[2-(4-hydroxyphenyl)ethyl]-7-methyl-2,5,8,11,14-pentaoxo-1,4,7,10,13-pentazacyclononadec-15-yl]carbamoylamino]-3-(4-hydroxyphenyl)propanoic acid	present	NPASS
(2S,3S,4R,5R,6S)-2-[(3S,4E,6E,8E,10E,12E,14E,16E,18E,20E,22E,24E)-2-hydroxy-25-[(4R)-4-hydroxy-2,6,6-trimethylcyclohexen-1-yl]-2,6,10,14,19,23-hexamethylpentacosa-4,6,8,10,12,14,16,18,20,22,24-undecaen-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3S,4R,5R,6S)-2-[(3S,4E,6E,8E,10E,12E,14E,16E,18E,20E,22E,24E,26E,28E,30S)-2,31-dihydroxy-2,6,10,14,19,23,27,31-octamethyl-30-[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxydotriaconta-4,6,8,10,12,14,16,18,20,22,24,26,28-tridecaen-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(3R,3'R,13-cis)-beta,beta-Carotene-3,3'-diol	present	NPASS
(D-Asp3, (Z)-Dhb7)microcystin-HtyR	present	NPASS
(D-Asp3, (Z)-Dhb7)microcystin-LR	present	NPASS
3'-Hydroxyechinenone	present	NPASS
3-[(1S,4S,10S,13S,16S,19S,25S,31S,34S,42S)-13-(2-amino-2-oxoethyl)-19-[3-(diaminomethylideneamino)propyl]-25-[(4-hydroxyphenyl)methyl]-42-(3-methylbut-2-enyl)-31-(2-methylpropyl)-2,5,11,14,17,20,23,26,29,32-decaoxo-4-propan-2-yl-3,6,12,15,18,21,24,27,30,33,35-undecazapentacyclo[31.10.0.06,10.034,42.036,41]tritetraconta-36,38,40-trien-16-yl]propanoic acid	present	NPASS
[(2R)-3-[[(2R)-1-[[(2S,5S,8S,11R,12S,15S,18S,21R)-15-(4-aminobutyl)-5-benzyl-2,8-bis[(2S)-butan-2-yl]-21-hydroxy-4,11-dimethyl-3,6,9,13,16,22-hexaoxo-10-oxa-1,4,7,14,17-pentazabicyclo[16.3.1]docosan-12-yl]amino]-4-(4-hydroxyphenyl)-1-oxobutan-2-yl]amino]-2-methoxy-3-oxopropyl] hydrogen sulfate	present	NPASS

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Romalea microptera has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes3

eDNA detections24

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

103Tmostly conserved

283Amostly conserved

454Cmostly conserved

457Tmostly conserved

518Gmostly conserved

640Tmostly conserved

TACTTTATACTTTTTATTTGGAGCATGAGCAGGAATAGTGGGTACATCAATAAGTATATTAATTCGAGCAGAATTAGGTCAGCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes5

BIN1

Most divergent pair1.1%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Taeniopoda gutturosasame family6.7%Taeniopoda centuriosame family6.8%Taeniopoda citricornissame family6.8%Taeniopoda auricornissame family6.8%Taeniopoda reticulatasame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P28S-D2-D3

animal barcoderibosomalmarker

06Genome at a glanceGoaT

The complete instruction manual Romalea microptera carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 231×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

2n 241×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type20 364 records

Wild obs. + sensor20 009

Museum / vouchered355

Range

Area of Occupancy AOO26 592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 11 401≤1 km 2 432≤10 km 1 144>10 km 2 022

16 999 georeferenced · 3 010 without coordinates

Open the mapobservation + sensor20 009

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤1 km 6≤10 km 65>10 km 4

75 georeferenced · 280 without coordinates

Open the institutions mapphysical evidence355

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	115
CUlocation not on record	80
University of Central Floridalocation not on record	44
Champaign, US	39
Mississippi State, US	29
College Station, US	10
Provo, US	10
Colorado State Universitylocation not on record	9
University of Alabamalocation not on record	7
University of Guelphlocation not on record	3
Montgomery, US	2
Washington, US	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Chicago, US	1
Chicago, US	1
University Park, US	1

16 institutions · 355 of 355 vouchered records shown

09Environmental DNA24 detections

Where the DNA of Romalea microptera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 21.2–27.7

Seasonal swing summer↔winter9.10 °C

Max temp (day)30.4 °C 25.2–31.5

Min temp (night)20.2 °C 17.8–25.2

Precipitation88.2 mm/mo 55.9–241

Air humidity59.2 % 56.9–63.2

Moisture balance-80.4 mm/mo -93.3–64.9

Vapour deficit1,344 Pa 1,026–1,399

Wind speed3.30 m/s 2.10–4.30

Cloud cover34.1 % 28.8–35.9

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Romalea microptera

At a glance

Sources10 archives

Compound class profile5 classes

Documented compounds40 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type20 364 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type20 364 records