Roesleria subterranea

(Weinm.) Redhead · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Helotiaceae/Roesleria

At a glance

Occurrence records46

Data sources7

Biological traits0

DNA specimens2

eDNA detections99

Sources7 archives

Databases and archives Roesleria subterranea's data was compiled from.

GBIFGlobal Biodiversity Information Facility46 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI99 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF46 records

Environmental DNA5 datasets · 9 countries99 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Roesleria subterranea has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences7

eDNA detections99

Countries9

The DNA barcodea real sequence read deposited for this species

ITSON963623.1 ↗239 bpLithuania

ACGT

AACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTTGACCACTCCCGCTTGCGGGGTCTTGGGCCTTCGC …

Roesleria subterranea isolate 5425_1431 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type46 records

Wild obs. + sensor5

Museum / vouchered40

Cultivated / captive1

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 2

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence40

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Southeastern Louisiana University, Vertebrate Museumlocation not on record	27
Oulu, FI	1
Karlsruhe, DE	1
PRClocation not on record	1
Helsinki, FI	1
Copenhagen, DK	1

6 institutions · 32 of 40 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA99 detections

Where the DNA of Roesleria subterranea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found99

Studies independent surveys5

Countries9

Verifiable raw sequence linked27

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 99 detections have coordinates

Open the map9 countries0

Palearcticroots

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 3.50–15.6

Seasonal swing summer↔winter22.6 °C

Max temp (day)15.2 °C 7.50–19.5

Min temp (night)8.20 °C -0.2–12.1

Precipitation75.7 mm/mo 49.8–107

Air humidity61.3 % 56.8–67.5

Moisture balance5.80 mm/mo -43.6–56.6

Vapour deficit548 Pa 272–720

Wind speed2.90 m/s 2.20–4.80

Cloud cover48.5 % 39.3–58.4

CHELSA 1981–2010, ~9 km grid, at location & month of 96 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)