Roccella phycopsis

Fungi/Ascomycota/Arthoniomycetes/Arthoniales/Roccellaceae/Roccella

At a glance

Occurrence records1 414

Data sources11

Biological traits1

DNA specimens8

eDNA detections20

Sources11 archives

Databases and archives Roccella phycopsis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 414 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Chemical compositionLOTUS · NPASS49 compounds

Occurrence & distributionGBIF1 414 records

Environmental DNA1 datasets · 0 countries20 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

DISPLAYTITLE Roccella tinctoria is a lichenised species of fungus in the genus Roccella, homotypic synonym of Lecanora tinctoria (DC.) Czerwiak., 1849. It was first described by Augustin Pyramus de Candolle in 1805. It has the following varieties: R. t. var. portentosa R. t. var. subpodicellata R. t. var. tinctoria and formae: R. t. f. complanata R. t. f. tinctoria

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

03Chemical composition49 compounds

Compounds documented for Roccella phycopsis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Fatty alcohols7

Flavones3

Eudesmane sesquiterpenoids3

Hydrocarbons2

Flavonols2

Documented compounds49 total

Compound	Amount	Source
(-)-alpha-Gurjunene	present	NPASS
(2E,8S,9Z)-heptadeca-2,9,16-trien-4,6-diyn-8-ol	present	NPASS
(2R,3R,4S,5S,6R)-2-[(E)-dec-8-en-4,6-diynoxy]-6-[[(2R,3R,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxymethyl]oxane-3,4,5-triol	present	NPASS
(2R,3R,4S,5S,6R)-2-[(E,3R)-3-hydroxydec-8-en-4,6-diynoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2R,3R,4S,5S,6R)-2-[(E,3S)-3-hydroxydec-8-en-4,6-diynoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2R,3R,4S,5S,6R)-2-[[(1R,2R,4R,4aR,5R,8aS)-4,5-dihydroxy-4a,8-dimethyl-2-propan-2-yl-2,3,4,5,6,8a-hexahydro-1H-naphthalen-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2R,3R,4S,5S,6R)-2-[[(1R,4S,4aR,8aR)-4-hydroxy-4,8a-dimethyl-6-propan-2-yl-1,2,3,4a,5,8-hexahydronaphthalen-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2R,3R,4S,5S,6R)-2-[[(1R,4S,4aR,8aR)-4-hydroxy-4,8a-dimethyl-6-propan-2-yl-1,2,3,4a,7,8-hexahydronaphthalen-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2R,3R,4S,5S,6R)-2-[[(1S,2S,4R,4aR,5R,8aS)-4,5-dihydroxy-2-(2-hydroxypropan-2-yl)-4a,8-dimethyl-2,3,4,5,6,8a-hexahydro-1H-naphthalen-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2S,3R,8S,9Z)-heptadeca-9,16-dien-4,6-diyne-2,3,8-triol	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Roccella phycopsis has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes1

GenBank sequences10

eDNA detections20

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ550140.1 ↗558 bpSpain · 2022

ACGT

TTAGAGATAGGGCCTGTCTAGGTCCGACCTCCAACCCCCTGTTTACCTAACCCATTGTTGCTTTGGCGATGCGTCTGGTGCTCGCCGTAC …

Roccella phycopsis voucher VAL_Lich 32822 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

08Occurrence & distribution

Record type1 414 records

Wild obs. + sensor992

Museum / vouchered416

Other6

Origin

Native41

Range

Area of Occupancy AOO2 172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 331≤1 km 355≤10 km 245>10 km 5

936 georeferenced · 56 without coordinates

Open the mapobservation + sensor992

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 16≤1 km 64≤10 km 75>10 km 11

166 georeferenced · 250 without coordinates

Open the institutions mapphysical evidence416

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 50 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TSBlocation not on record	64
Berlin, DE	50
MeiseBGlocation not on record	36
Durham, US	28
Stockholm, SE	28
ASUlocation not on record	20
LDlocation not on record	16
Barcelona, ES	14
Museo Achille Folettolocation not on record	14
US	14
BDBClocation not on record	13
CLUlocation not on record	11
Madison, US	10
Madrid, ES	8
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	7
Paris, FR	7
DOI/NPS, Colonial National Historical Parklocation not on record	7
Olocation not on record	6
MAlocation not on record	5
San Sebastián, ES	4
Chicago, US	4
South Kensington, GB	4
University of Gdansklocation not on record	3
University of Stellenboschlocation not on record	3
BClocation not on record	3
University of Hamburglocation not on record	3
UNITOlocation not on record	3
València, ES	2
Uppsala, SE	2
Weber State Universitylocation not on record	2
Kew, GB	2
Bronx, US	2
UAclocation not on record	2
EL PASO, US	1
CJBGlocation not on record	1
US	1
Philadelphia, US	1
UFMSlocation not on record	1
IPA/SPlocation not on record	1
St. Paul, US	1
Vitoria, ES	1
Trondheim, NO	1
Helsinki, FI	1
PHlocation not on record	1
Edinburgh, GB	1
Wlocation not on record	1
Santa Barbara, US	1
BG-NMNHSlocation not on record	1
Musée des Confluenceslocation not on record	1
GZUlocation not on record	1

50 institutions · 414 of 416 vouchered records shown · 2 without an institution code

09Environmental DNA20 detections

Where the DNA of Roccella phycopsis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources11 archives

Habitat & environment1

Compound class profile5 classes

Documented compounds49 total

At a glance

Record type1 414 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions24 of 50 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 414 records