Roccella montagnei — The Life Data

Fungi/Ascomycota/Arthoniomycetes/Arthoniales/Roccellaceae/Roccella

At a glance

Occurrence records376

Data sources7

Biological traits1

DNA specimens80

eDNA detections80

Sources7 archives

Databases and archives Roccella montagnei's data was compiled from.

GBIFGlobal Biodiversity Information Facility376 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI80 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics80 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF376 records

Environmental DNA1 datasets · 0 countries80 detections

DNA & barcodingBOLD · NCBI80 specimens

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

03Chemical composition8 compounds

Compounds documented for Roccella montagnei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Shikimic acids and derivatives $ Simple phenolic acids5

Depsides $ Simple phenolic acids1

Depsides1

Documented compounds8 total

Compound	Amount	Source
CID 12308904	present	LOTUS
Hydrofurylmontagnetol	present	LOTUS
Montagnetol	present	LOTUS
Orsellinylmontagnetol A	present	LOTUS
Orsellinylmontagnetol B	present	LOTUS
Orsellinylmontagnetol C	present	LOTUS
Orsellinylmontagnetol D	present	LOTUS
Roccellatol	present	LOTUS

05DNA & barcoding80 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Roccella montagnei has left across the world's sequence archives.

At a glance

DNA specimens80

Marker genes2

GenBank sequences10

eDNA detections80

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU137907.1 ↗561 bp

ACGT

GTCCGGGCCCGACCTCCAACCCCCTGTCTACCTCTCCACTGTTGCTTTGGCGGTACGTCTGGTGCTTGCCGTACGCGCTACGGTCGAGGG …

Roccella montagnei voucher Ertz 13036 (BR-7387-15) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10ITS1

fungal barcode

08Occurrence & distribution

Record type376 records

Wild obs. + sensor17

Museum / vouchered359

Range

Area of Occupancy AOO692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 10≤1 km 2>10 km 2

14 georeferenced · 3 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 2≤1 km 6≤10 km 38>10 km 10

56 georeferenced · 303 without coordinates

Open the institutions mapphysical evidence359

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	120
South Kensington, GB	51
Bronx, US	23
Uppsala, SE	22
University of Stellenboschlocation not on record	20
Brisbane, AU	19
MeiseBGlocation not on record	18
Berlin, DE	15
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	12
Palmerston, AU	6
Olocation not on record	5
Museo Entomologico de Leonlocation not on record	5
DOI/NPS, Colonial National Historical Parklocation not on record	5
Auckland, NZ	4
LDlocation not on record	4
Philadelphia, US	3
Kensington, AU	3
Pondicherry, IN	3
Durham, US	3
Pretoria, ZA	2
PHlocation not on record	2
M-Lichenslocation not on record	2
Chicago, US	2
Helsinki, FI	2
Canberra, AU	2
US	2
Bergen, NO	1
Hobart, AU	1
Madison, US	1
St. Paul, US	1

30 institutions · 359 of 359 vouchered records shown

09Environmental DNA80 detections

Where the DNA of Roccella montagnei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found80

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 80 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.