Robinsonia deiopea

Druce, 1895 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Robinsonia

At a glance

Occurrence records117

Data sources6

Biological traits0

DNA specimens35

eDNA detections33

Sources6 archives

Databases and archives Robinsonia deiopea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility117 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF117 records

Environmental DNA1 datasets · 4 countries33 detections

DNA & barcodingBOLD35 specimens

01Narrative

Robinsonia deiopea is a moth in the family Erebidae. It was described by Herbert Druce in 1895. It is found in Belize and Costa Rica.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Robinsonia deiopea has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes1

eDNA detections33

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

5Tmostly conserved

37Amostly conserved

290Amostly conserved

340Tmostly conserved

433Gmostly conserved

514Amostly conserved

553Amostly conserved

557Cmostly conserved

628Amostly conserved

AACATTATATTTCATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCCCTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes10

BIN1

Most divergent pair1.1%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Robinsonia dewitzisame genus4.6%Robinsonia rockstoniasame genus5.3%Robinsonia flavomarginatasame genus5.5%Robinsonia sabatasame genus5.6%Robinsonia bolivianasame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type117 records

Wild obs. + sensor34

Museum / vouchered83

Range

Area of Occupancy AOO240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 8≤1 km 4≤10 km 5>10 km 5

22 georeferenced · 12 without coordinates

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	65
Mississippi State, US	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	2
Uniwersytet Jagiellońskilocation not on record	1

5 institutions · 80 of 83 vouchered records shown · 3 without an institution code

09Environmental DNA33 detections

Where the DNA of Robinsonia deiopea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 23.4–25.0

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.2 °C 25.8–27.7

Min temp (night)21.9 °C 19.6–22.8

Precipitation349 mm/mo 72.5–473

Air humidity73.4 % 65.8–75.3

Moisture balance196 mm/mo -82.1–345

Vapour deficit831 Pa 707–1,061

Wind speed2.30 m/s 0.9–4.00

Cloud cover38.5 % 21.9–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)